Gene Details:

  • Gene ID: AT5G18300
  • Gene Symbol: anac088, NAC088
  • Gene Name: NAC domain containing protein 88, NAC domain containing protein 88
  • Description: NAC domain containing protein 88;(source:Araport11)
  • TAIR Accession: locus:2146278
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Gene Ontology:

  • GO:0003677  — enables — DNA binding
  • GO:0032870  — acts upstream of or within — cellular response to hormone stimulus
  • GO:0006355  — acts upstream of or within — regulation of DNA-templated transcription
  • GO:0098542  — acts upstream of or within — defense response to other organism
  • GO:1901362  — acts upstream of or within — organic cyclic compound biosynthetic process
  • GO:0003700  — enables — DNA-binding transcription factor activity
  • GO:0006355  — involved in — regulation of DNA-templated transcription
  • GO:0060560  — acts upstream of or within — developmental growth involved in morphogenesis
  • GO:0007165  — acts upstream of or within — signal transduction
  • GO:0009617  — acts upstream of or within — response to bacterium
  • GO:1901701  — acts upstream of or within — cellular response to oxygen-containing compound
  • GO:0005634  — located in — nucleus

Literature:

Sequence:

cDNA Sequence
  • >AT5G18300.1 ATGATGCCGATGACTGAAGAATTTTACGATGAAGAGGAAGAGCTTGGTTGCTTTAGATTTAATCCTTCAGAAGAAGAACTCATACTCGATTATCTTCTACCAAAGCTTGGCTTCCACCAACCAAACACGATATATTTGTTAGAAGACAGGGACAACATCTACGCCAAAGAGCCGTGGCGGCTTAATCACACAGAGAATGATATCTTTGAACCTAACGAGTGGTTTTATTTCGTGAAAAGGACAAATCGCAAAGTTAAAGGTTGGAAAGCCACTGGAGAGTTAAAAGATGTCGTGTCGAAGAAAACCGGTGAAGTGATCGGGAAGAAGAGGAATCTCAGGTTCTACGTTGAAGGTGATGAGAGCAAAACGAGTGGTTGGACCATGAGGGAGTATTCTTCCATTGGCAATCAAAACCAACGTCTCTGCCACCTTAAAGGACCATGA
CDS Sequence
Protein Sequence