Gene Details:
- Gene ID: AT5G18300
- Gene Symbol: anac088, NAC088
- Gene Name: NAC domain containing protein 88, NAC domain containing protein 88
- Description: NAC domain containing protein 88;(source:Araport11)
- TAIR Accession: locus:2146278
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0003677 — enables — DNA binding
- GO:0032870 — acts upstream of or within — cellular response to hormone stimulus
- GO:0006355 — acts upstream of or within — regulation of DNA-templated transcription
- GO:0098542 — acts upstream of or within — defense response to other organism
- GO:1901362 — acts upstream of or within — organic cyclic compound biosynthetic process
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0060560 — acts upstream of or within — developmental growth involved in morphogenesis
- GO:0007165 — acts upstream of or within — signal transduction
- GO:0009617 — acts upstream of or within — response to bacterium
- GO:1901701 — acts upstream of or within — cellular response to oxygen-containing compound
- GO:0005634 — located in — nucleus
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DOI: 10.1093/dnares/10.6.239 ; PMID: 15029955
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Sequence:
cDNA Sequence
- >AT5G18300.1 ATGATGCCGATGACTGAAGAATTTTACGATGAAGAGGAAGAGCTTGGTTGCTTTAGATTTAATCCTTCAGAAGAAGAACTCATACTCGATTATCTTCTACCAAAGCTTGGCTTCCACCAACCAAACACGATATATTTGTTAGAAGACAGGGACAACATCTACGCCAAAGAGCCGTGGCGGCTTAATCACACAGAGAATGATATCTTTGAACCTAACGAGTGGTTTTATTTCGTGAAAAGGACAAATCGCAAAGTTAAAGGTTGGAAAGCCACTGGAGAGTTAAAAGATGTCGTGTCGAAGAAAACCGGTGAAGTGATCGGGAAGAAGAGGAATCTCAGGTTCTACGTTGAAGGTGATGAGAGCAAAACGAGTGGTTGGACCATGAGGGAGTATTCTTCCATTGGCAATCAAAACCAACGTCTCTGCCACCTTAAAGGACCATGA
CDS Sequence
Protein Sequence