Gene Details:
- Gene ID: AT5G19790
- Gene Symbol: RAP2.11
- Gene Name: related to AP2 11
- Description: related to AP2 11;(source:Araport11)
- TAIR Accession: locus:2183174
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000256 — root hair cell — célula del pelo de la raíz (Spanish, exact), 根毛細胞 (Japanese, exact)
- PO:0003015 — primary root differentiation zone — zona de diferenciación de la raíz primary (Spanish, exact), 一次根分化帯(層) (Japanese, exact)
- PO:0005679 — plant epidermis — dermal tissue (exact), epidermal layer (exact), epidermides (exact, plural), epidermis (Spanish, exact), epidermises (exact, plural), portion of epidermal tissue (exact), 表皮 (Japanese, exact), multiseriate epidermis (related)
Gene Ontology:
- GO:0006355 — acts upstream of or within — regulation of DNA-templated transcription
- GO:0000302 — acts upstream of or within — response to reactive oxygen species
- GO:0048528 — acts upstream of or within — post-embryonic root development
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0005634 — located in — nucleus
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0035865 — acts upstream of or within — cellular response to potassium ion
- GO:0009723 — acts upstream of or within — response to ethylene
- GO:0003677 — enables — DNA binding
- GO:0043565 — enables — sequence-specific DNA binding
Function-related keywords:
Literature:
- The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis. DOI: 10.1073/pnas.94.13.7076 ; PMID: 9192694
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: and shoot-specific genes. DOI: 10.1111/j.1365-313X.2004.02051.x ; PMID: 15078338
- Dynamic histone acetylation of late embryonic genes during seed germination. DOI: 10.1007/s11103-005-2081-x ; PMID: 16307366
- Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots. DOI: 10.1073/pnas.0510607103 ; PMID: 16581911
- The barley ERF-type transcription factor HvRAF confers enhanced pathogen resistance and salt tolerance in Arabidopsis. DOI: 10.1007/s00425-006-0373-2 ; PMID: 16937017
- Integration of Arabidopsis thaliana stress-related transcript profiles, promoter structures, and cell-specific expression. DOI: 10.1186/gb-2007-8-4-r49 ; PMID: 17408486
- Arabidopsis NRT1.5 Mediates the Suppression of Nitrate Starvation-Induced Leaf Senescence by Modulating Foliar Potassium Level. DOI: 10.1016/j.molp.2015.12.015 ; PMID: 26732494
- Potassium transporter TRH1/KUP4 contributes to distinct auxin-mediated root system architecture responses. DOI: 10.1093/plphys/kiab472 ; PMID: 34633458
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Genome-wide analysis of the ERF gene family in Arabidopsis and rice. DOI: 10.1104/pp.105.073783 ; PMID: 16407444
- Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots. DOI: 10.1073/pnas.0510607103 ; PMID: 16581911
Sequence:
cDNA Sequence
- >AT5G19790.1 AAAAAAATATGGAACATCAAACAACTCCAAAGCAGAAAACTAAGGAGAAGAGCAAAGGCAACAAGACTAAGTTTGTGGGAGTTAGGCAAAGGCCTTCAGGAAAATGGGTGGCAGAGATCAAAGACACTACACAAAAGATACGGATGTGGCTCGGAACCTTTGAAACCGCAGAAGAAGCCGCTCGAGCCTACGATGAAGCTGCATGTCTCTTACGTGGCTCCAATACTCGCACCAATTTCGCAAACCATTTTCCTAACAACTCACAACTATCTTTGAAGATCAGAAATCTTCTTCACCAGAAGCAGAGCATGAAGCAGCAGCAACAACAACAACACAAACCAGTTTCTTCTTTAACGGATTGCAACATCAACTACATCTCGACTGCTACTAGTCTCACCACAACCACCACCACCACCACTACCACGGCCATACCGCTCAATAATGTGTACCGACCAGATTCATCGGTCATTGGGCAACCAGAAACCGAGGGTCTCCAGCTTCCTTATTCGTGGCCCCTTGTCTCTGGATTCAACCATCAGATTCCATTGGCTCAGGCAGGGGGAGAAACACATGGACATCTCAACGATCACTACTCAACCGATCAACATTTGGGTCTTGCAGAAATTGAAAGACAGATATCTGCGTCCCTATATGCAATGAATGGAGCTAACAGTTACTATGACAACATGAATGCAGAATATGCAATTTTCGATCCTACCGATCCCATTTGGGATCTCCCTTCACTCTCCCAACTCTTCTGCCCTACGTGATTTCCAATTTACTTTTCCTGATCAATTCATGTAATGTTTGGATCAATGATCCATGATTGTAAAGTAGAACACATCTCTACAATGTTCCAATAGACAAGATTGTACCTAAAGAAAATGGACAATGTAAGAAGATAATGAAGGTTTCGTACAACAAAAGCTTGAT
CDS Sequence
Protein Sequence