Gene Details:
- Gene ID: AT5G20820
- Gene Symbol: AtSAUR76, SAUR76
- Gene Name: SMALL AUXIN UPREGULATED RNA 76
- Description: SAUR-like auxin-responsive protein family;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Function-related keywords:
Literature:
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Transcriptome analysis of Arabidopsis clubroots indicate a key role for cytokinins in disease development. DOI: 10.1094/MPMI-19-0480 ; PMID: 16673935
- Upregulation of an Arabidopsis RING-H2 gene, XERICO, confers drought tolerance through increased abscisic acid biosynthesis. DOI: 10.1111/j.1365-313X.2006.02782.x ; PMID: 16792696
- Different plant hormones regulate similar processes through largely nonoverlapping transcriptional responses. DOI: 10.1016/j.cell.2006.05.050 ; PMID: 16901781
- Characterization of the VIER F-BOX PROTEINE genes from Arabidopsis reveals their importance for plant growth and development. DOI: 10.1105/tpc.105.040675 ; PMID: 17435085
- Arabidopsis thaliana plants acclimated to low dose rates of ultraviolet B radiation show specific changes in morphology and gene expression in the absence of stress symptoms. DOI: 10.1111/j.1469-8137.2007.02092.x ; PMID: 17587374
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Identification of genes involved in the ACC-mediated control of root cell elongation in Arabidopsis thaliana. DOI: 10.1186/1471-2229-12-208 ; PMID: 23134674
- Three SAUR proteins SAUR76, SAUR77 and SAUR78 promote plant growth in Arabidopsis. DOI: 10.1038/srep12477 ; PMID: 26207341
Sequence:
cDNA Sequence
- >AT5G20820.1 CTACCCTTAGCAAGTTATATAAGAACATCATTCTCCTTTCTCTCTTCGACATCGACATTCCTCTTCCTCGCTTCTCTCTCTCTCTCTCTCTCACCGGAAAACTCACTCGGACTTACATTTCCGACGTCAAACTTCTCCAAACCGAATCGGTAATGGCGAAAGGAGGAAACAAACTGATGAAGCTGAAATCAGTTTTGAAGAAACTCAATTCATTCAACACCAAGCCTAACCAGCCACCAGCTCAAACCAATCACAGCCGATCCTCCGCCGTGAGTGCGTTCCCCTCTGAAGACCTTCAAACTGTCTACGTAGGCCGAACACGGAGGACATACCACGTGAGCTCCGATGTCGTGAGCCACCCGCTCTTCCAGCAGCTAGCGGCGGTGGATGGTGGATGCGGCAGCGAGGACGGTTCCATCTCTGTGTCGTGCGAAGTTGTCTTGTTTGAGCATTTGCTTTGGATGTTGGAGAACGCCGACGCCGATGAGTCACGCCCCGAGTCGGTCTACGAACTTGTCGAGTTCTACGCTTGTTAACTCTTTATGATTAATTTAGGTTCAAAATATATTTATGATTAAATGTTACATGTTTGTATATTCTACACTTTGTATACTTTACACTTTACATAGTATTTCGTGAAATAATCTATTTTCTGTTAAATGATACAACAACGATAAAATAAATGTTTAAATGTGTAAAT
CDS Sequence
Protein Sequence