Gene Details:
- Gene ID: AT5G23900
- Gene Symbol: eL13x
- Gene Name: Ribosomal Protein eL13x
- Description: Ribosomal protein L13e family protein;(source:Araport11)
- TAIR Accession: locus:2172863
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0006412 — involved in — translation
- GO:0022626 — located in — cytosolic ribosome
- GO:0022625 — located in — cytosolic large ribosomal subunit
- GO:0009536 — located in — plastid
- GO:0005737 — located in — cytoplasm
- GO:0022625 — part of — cytosolic large ribosomal subunit
- GO:0003723 — enables — RNA binding
- GO:0003735 — enables — structural constituent of ribosome
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- The age of the Arabidopsis thaliana genome duplication. DOI: 10.1023/a:1023001130337 ; PMID: 12777046
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
Sequence:
cDNA Sequence
- >AT5G23900.1 TATATATCGAATTATCGATGAACAATTAGCCCCTCTGGAGAAGCCTTCACTTTTCGTCCAAGCCGCTAAAAATGAAGCACAACAACGTTATCCCGAGCTCACACTTTCGCAAGCACTGGCAGAATTATGTCAAGACTTGGTTTAACCAGCCTGCCAGGAAGACAAGGAGACGTGTTGCTAGACAGAAGAAGGCTGTGAAGATCTTCCCTCGTCCCACCTCTGGTCCTCTCCGACCTGTTGTTCATGGTCAGACACTTAAGTACAACATGAAAGTTAGAGCTGGAAAAGGATTCACTCTTGAAGAGCTTAAGGTTGCTGGTATCCCAAAGAAGTTGGCTCCAACAATCGGAATTTCTGTTGATCACCGACGCAAGAACCGTTCTTTGGAGGGTCTTCAGTCCAATGTCCAAAGGTTAAAGACTTACAAGGCTAAGTTGGTGGTGTTCCCTCGCCGTTCCCGTCAAGTCAAGGCTGGTGATTCTACTCCAGAGGAGCTTGCCAATGCTACTCAAGTTCAAGGTGATTACATGCCAATTGCCAGTGTCAAGGCAGCTATGGAGCTAGTTAAGCTGACTGCAGATTTGAAGGCGTTCAAGGCTTACGATAAGATTCGTTTGGAGCGCACAAACGCACGTCATGCTGGTGCCAGAGCCAAGAGGGCTGCCGAGGCTGAGAAAGAAGAGAAGAAGTAAAATTCGTTGCTTTATAGAGCTTAATCATTCTTGAATTCTTGTTCTTCTGGTTTTTGATTTTGTGCACGACTCTGTTTTCTTTTTGGTGCGGTTTATCAATACATAGATCTCAAAGGTTTCTGGTACTTGGGAAAGTTTATGGAAGAAATTATAACGAGTTTCTATATACGTATCTTATATTACAACTTAGTATAAACTTTCGTAGACATTGTACTGATGATAAGCCTAATTCAACAGACTAATACGATACGCGA
CDS Sequence
Protein Sequence