Gene Details:
- Gene ID: AT5G24770
- Gene Symbol: ATVSP2, VSP2
- Gene Name: vegetative storage protein 2
- Description: vegetative storage protein 2;(source:Araport11)
- TAIR Accession: locus:2184580
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0002213 — acts upstream of or within — defense response to insect
- GO:0006979 — acts upstream of or within — response to oxidative stress
- GO:0009753 — acts upstream of or within — response to jasmonic acid
- GO:0000325 — located in — plant-type vacuole
- GO:0022626 — located in — cytosolic ribosome
- GO:0003993 — enables — acid phosphatase activity
- GO:0009611 — acts upstream of or within — response to wounding
- GO:0009507 — located in — chloroplast
- GO:0042538 — acts upstream of or within — hyperosmotic salinity response
- GO:0046688 — acts upstream of or within — response to copper ion
- GO:0009625 — acts upstream of or within — response to insect
Literature:
- The Arabidopsis mutant cev1 has constitutively active jasmonate and ethylene signal pathways and enhanced resistance to pathogens. DOI: 10.1105/tpc.13.5.1025 ; PMID: 11340179
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- Activation tagging of a gene for a protein with novel class of CCT-domain activates expression of a subset of sugar-inducible genes in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2005.02439.x ; PMID: 15960623
- Arabidopsis vegetative storage protein is an anti-insect acid phosphatase. DOI: 10.1104/pp.105.066837 ; PMID: 16258019
- 12-oxo-phytodienoic acid triggers expression of a distinct set of genes and plays a role in wound-induced gene expression in Arabidopsis. DOI: 10.1104/pp.105.067058 ; PMID: 16258017
- Roles of ethylene receptor NTHK1 domains in plant growth, stress response and protein phosphorylation. DOI: 10.1016/j.febslet.2006.01.037 ; PMID: 16442528
- WRKY62 transcription factor acts downstream of cytosolic NPR1 and negatively regulates jasmonate-responsive gene expression. DOI: 10.1093/pcp/pcm058 ; PMID: 17510065
- Jasmonate biosynthesis in Arabidopsis thaliana requires peroxisomal beta-oxidation enzymes–additional proof by properties of pex6 and aim1. DOI: 10.1016/j.phytochem.2007.04.024 ; PMID: 17544464
- HDA6 is required for jasmonate response, senescence and flowering in Arabidopsis. DOI: 10.1093/jxb/erm300 ; PMID: 18212027
- The role of JAR1 in Jasmonoyl-L: -isoleucine production during Arabidopsis wound response. DOI: 10.1007/s00425-008-0694-4 ; PMID: 18247047
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Ethylene modulates the role of NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 in cross talk between salicylate and jasmonate signaling. DOI: 10.1104/pp.108.133926 ; PMID: 19176718
- Thaxtomin A affects CESA-complex density, expression of cell wall genes, cell wall composition, and causes ectopic lignification in Arabidopsis thaliana seedlings. DOI: 10.1093/jxb/ern344 ; PMID: 19269997
- Autophagy negatively regulates cell death by controlling NPR1-dependent salicylic acid signaling during senescence and the innate immune response in Arabidopsis. DOI: 10.1105/tpc.109.068635 ; PMID: 19773385
- Ethylene signaling renders the jasmonate response of Arabidopsis insensitive to future suppression by salicylic Acid. DOI: 10.1094/MPMI-23-2-0187 ; PMID: 20064062
- CML42-mediated calcium signaling coordinates responses to Spodoptera herbivory and abiotic stresses in Arabidopsis. DOI: 10.1104/pp.112.198150 ; PMID: 22570470
- Rewiring of the Jasmonate Signaling Pathway in Arabidopsis during Insect Herbivory. DOI: 10.3389/fpls.2011.00047 ; PMID: 22645537
- The lateral organ boundaries domain transcription factor LBD20 functions in Fusarium wilt Susceptibility and jasmonate signaling in Arabidopsis. DOI: 10.1104/pp.112.199067 ; PMID: 22786889
- E-2-hexenal promotes susceptibility to Pseudomonas syringae by activating jasmonic acid pathways in Arabidopsis. DOI: 10.3389/fpls.2013.00074 ; PMID: 23630530
- ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to and ethylene-responsive defence genes. DOI: 10.1111/pce.12583 ; PMID: 26038230
- The Arabidopsis Mediator Complex Subunit16 Is a Key Component of Basal Resistance against the Necrotrophic Fungal Pathogen Sclerotinia sclerotiorum. DOI: 10.1104/pp.15.00351 ; PMID: 26143252
- Paired Hierarchical Organization of 13-Lipoxygenases in Arabidopsis. DOI: 10.3390/plants5020016 ; PMID: 27135236
- Arabidopsis plants having defects in nonsense-mediated mRNA decay factors UPF1, UPF2, and UPF3 show photoperiod-dependent phenotypes in development and stress responses. DOI: 10.1111/j.1744-7909.2012.01093.x ; PMID: 22353561
- Assessing the Role of ETHYLENE RESPONSE FACTOR Transcriptional Repressors in Salicylic Acid-Mediated Suppression of Jasmonic Acid-Responsive Genes. DOI: 10.1093/pcp/pcw187 ; PMID: 27837094
- Salt hypersensitive mutant 9, a nucleolar APUM23 protein, is essential for salt sensitivity in association with the ABA signaling pathway in Arabidopsis. DOI: 10.1186/s12870-018-1255-z ; PMID: 29490615
- Chitosan Oligosaccharide Induces Resistance to Pseudomonas syringae pv. tomato and Jasmonic Acid-Mediated Pathways. DOI: 10.1094/MPMI-03-18-0071-R ; PMID: 29869942
- Sodium chloride primes JA-independent defense against Spodoptera litura (Fabricius) larvae in Arabidopsis thaliana. DOI: 10.1080/15592324.2019.1607466 ; PMID: 31021696
- Oligogalacturonides induce resistance in Arabidopsis thaliana by triggering salicylic acid and jasmonic acid pathways against Pst DC3000. DOI: 10.1016/j.ijbiomac.2020.09.026 ; PMID: 32910959
- AtOZF1 positively regulates JA signaling and SA-JA cross-talk in Arabidopsis thaliana. DOI: 8 ; PMID: 35092410
- The MIK2/SCOOP Signaling System Contributes to Arabidopsis Resistance Against Herbivory by Modulating Jasmonate and Indole Glucosinolate Biosynthesis. DOI: 10.3389/fpls.2022.852808 ; PMID: 35401621
- Proteomic Analysis of Proteins Related to Defense Responses in Arabidopsis Plants Transformed with the rolB Oncogene. DOI: 10.3390/ijms24031880 ; PMID: 36768198
- Trichoderma hamatum can act as an inter-plant communicator of foliar pathogen infections by colonizing the roots of nearby plants: A new inter-plant "wired communication". DOI: 10.1016/j.plantsci.2023.111664 ; PMID: 36858205
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Arabidopsis vegetative storage protein is an anti-insect acid phosphatase. DOI: 10.1104/pp.105.066837 ; PMID: 16258019
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
Sequence:
cDNA Sequence
- >AT5G24770.1 ACTCACATCAACATATTCAATACATTTTTCTAGTAATGTAGAACAACTTTACAGTATTCTCCAAAACGAAACTCTAATTCAAAATTTACAAGCAGATAAGCCAAAGATAATAGAACAACAAAACGCCAAATTCTAGTTAAGCACACAATCTCAACGTGCACTAAAAACGAGTGGTGTAAGTGAAAAATATCGTCGATTATAAACATTATGGGACCAGTAGCATTTGTTGCACCAATCGAAAACAGACAAGCACACATATCTCCTCATTTCTCATCTGGCTTCTTAATCATTTCTCATAACCCCACCTCATTATAAATACCACCCTTTGCGTCACACATATAAACATCACAAACTAAACAATAAACCATACCATAAAAAACATGAAAATCCTCTCACTTTCACTTCTCTTGCTCTTGGCCGCTACGGTCTCGGCATCCGTTCCAGGGCTCATCGAACTCGTCGATTCGAAAACCATCTTTGGGAACGTAGCCGAACTCTTAGAGAAAGAGAAACTTTCCATCAACTACGCCAACTGCAGAAGCTGGCACCTTGGTGTTGAGACCTCTAACATCATAGACTTCGACACGGTGCCCGCAAATTGCAAAGACTATGTTGAAGACTACTTGATCACTTCCAAACAGTACCAATACGACTCCAAAACCGTGTGCAAAGAGGCTTATTTCTATGCCAAAGGACTTGCCCTAAAGAACGACACCGTCAATGTTTGGATCTTTGACCTAGATGATACCCTCCTCTCTAGTATTCCCTACTACGCAAAATATGGATACGGAACAGAGAAGACCGACCCGGGGGCGTACTGGTTGTGGTTAGGGACCGGAGCATCAACCCCTGGACTCCCGGAGGCCTTGCATCTTTACCAAAACATCATAGAGCTCGGGATTGAACCCATCATACTCAGTGACCGTTGGAAGTTGTGGAAGAATGTCACTCTCGACAATCTCGAAGCTGCTGGCGTGACCTACTGGAAGCATCTCATATTGAAGCCTAATGGTTCGAACTTGAGGCAAGTGGTGTACAAGTCAAAGGTGAGGAAGAGTCTCGTGAAGAAAGGATACAACATCGTTGGCAATATCGGAGATCAATGGGCTGATTTGGTTGAGGATACCCCTGGGAGGGTTTTTAAGCTCCCAAATCCACTCTACTACGTACCTTCTTAAGAATCTATCTTCATCGCATTGTCCCCTTGTATACACTTCATATCTATGTCGTTTCGTTTATCTTTGTAGCCGTTTTGGCACCGCTGCATAAATAAAATGTCTATCCTATCGTAACTTAATAAGTACAAAGACTTCGTACTAAATGTTGTTTTTCTTTAAAGGGGTCATTAATTAAGTGGCCATGAAATGATATTCACCATGTAAATCTAATACAATGAAAAGTATAAATTTGAACTGGAAACTAA
- >AT5G24770.2 ACTCACATCAACATATTCAATACATTTTTCTAGTAATGTAGAACAACTTTACAGTATTCTCCAAAACGAAACTCTAATTCAAAATTTACAAGCAGATAAGCCAAAGATAATAGAACAACAAAACGCCAAATTCTAGTTAAGCACACAATCTCAACGTGCACTAAAAACGAGTGGTGTAAGTGAAAAATATCGTCGATTATAAACATTATGGGACCAGTAGCATTTGTTGCACCAATCGAAAACAGACAAGCACACATATCTCCTCATTTCTCATCTGGCTTCTTAATCATTTCTCATAACCCCACCTCATTATAAATACCACCCTTTGCGTCACACATATAAACATCACAAACTAAACAATAAACCATACCATAAAAAACATGAAAATCCTCTCACTTTCACTTCTCTTGCTCTTGGCCGCTACGGTCTCGGCATCCGTTCCAGGGCTCATCGAACTCGTCGATTCGAAAACCATCTTTGGGAACGTAGCCGAACTCTTAGAGAAAGAGAAACTTTCCATCAACTACGCCAACTGCAGAAGCTGGCACCTTGGTGTTGAGACCTCTAACATCATAGACTTCGACACGGTGCCCGCAAATTGCAAAGACTATGTTGAAGACTACTTGATCACTTCCAAACAGTACCAATACGACTCCAAAACCGTGTGCAAAGAGGCTTATTTCTATGCCAAAGGACTTGCCCTAAAGAACGACACCGTCAATGTTTGGATCTTTGACCTAGATGATACCCTCCTCTCTAGTATTCCCTACTACGCAAAATATGGATACGGAACAGAGAAGACCGACCCGGGGGCGTACTGGTTGTGGTTAGGGACCGGAGCATCAACCCCTGGACTCCCGGAGGCCTTGCATCTTTACCAAAACATCATAGAGCTCGGGATTGAACCCATCATACTCAGTGACCGTTGGAAGTTGTGGAAGAATGTCACTCTCGACAATCTCGAAGCTGCTGGCGTGACCTACTGGAAGCATCTCATATTGAAGCCTAATGGTTCGAACTTGAGGCAAGTGGTGTACAAGTCAAAGGTGAGGAAGAGTCTCGTGAAGAAAGGATACAACATCGTTGGCAATATCGGAGATCAATGGGCTGATTTGGTTGAGGATACCCCTGGGAGGGTTTTTAAGCTCCCAAATCCACTCTACTACGTACCTTCTTAAGAATCTATCTTCATCGCATTGTCCCCTTGTATACACTTCATATCTATGTCGTTTCGTTTATCTTTGTAGCCGTTTTGGCACCGCTGCATAAATAAAATGTCTATCCTATCGTAACTTAATAAGTACAAAGACTTCGTACTAAATGTTGTTTTTCTTTAAAGGGGTCATTAATTAAGTGGCCATGAAATGATATTCACCATGTAAATCTAATACAATGAAAAGTATAAATTTGAACTGGAAACTAA
CDS Sequence
Protein Sequence