Gene Details:

  • Gene ID: AT5G25350
  • Gene Symbol: EBF2
  • Gene Name: EIN3-binding F box protein 2
  • Description: EIN3-binding F box protein 2;(source:Araport11)
  • TAIR Accession: locus:2145512
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Plant Ontology Annotations:

  • PO:0000013  — cauline leaf — hoja caulinar (Spanish, exact), 茎生葉、茎葉 (Japanese, exact)
  • PO:0000014  — rosette leaf — hoja en roseta (Spanish, exact), ロゼット葉 (Japanese, exact)
  • PO:0009001  — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
  • PO:0009005  — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
  • PO:0009046  — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
  • PO:0009047  — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
  • PO:0000084  — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)

Gene Ontology:

  • GO:0006511  — acts upstream of or within — ubiquitin-dependent protein catabolic process
  • GO:0010105  — acts upstream of or within — negative regulation of ethylene-activated signaling pathway
  • GO:0009723  — acts upstream of or within — response to ethylene
  • GO:0005515  — enables — protein binding
  • GO:0031146  — involved in — SCF-dependent proteasomal ubiquitin-dependent protein catabolic process
  • GO:0009507  — located in — chloroplast
  • GO:0005634  — located in — nucleus
  • GO:0019005  — part of — SCF ubiquitin ligase complex

Germplasm Phenotype:

  • ebf1-1 ebf2-1  — Double mutants exhibits a clearly detectable delay in bolting time: plants had still not bolted by ~25 days after the mean bolting time of WT in LDs.
  • ebf1-1 ebf2-1  — GA treatment did not restore a normal growth phenotype or floral transition to double mutant plants grown in SDs.
  • ebf1-1 ebf2-1  — The double mutant is still responsive to ethylene. Moreover, inhibitors of ethylene perception or biosynthesis including AgNO3 and aminoethoxyvinyl glycine (AVG) could not suppress the constitutive triple response (ctr1).
  • ebf1-1 ebf2-1  — The mutant shows dwarfed growth, supernumerary epinastically curled leaves, early senescence, and abnormal flowers with the gynoecium protruding from the unopened floral buds. However, the phenotypes seen in double mutant plants are more severe than those seen in ctr1. This becomes apparent at about two weeks after germination, except for the reduced root growth, which is already obvious at three days after germination. Moreover, unlike the ctr1 mutation that has a reduced transmission of the ctr1 allele relative to wild-type and infertile early flowers, the double mutants have a greatly reduced fertility but can readily be pollinated with wild-type pollen.
  • ebf1-1 ebf2-1  — When germinated in the dark, the mutant display a ctr1-like phenotype (short hypocotyls, short roots, and exaggerated apical hooks).
  • ebf1-1 ebf2-1  — When grown in the light, the double mutants display slightly longer hypocotyls, curled unexpanded cotyledons, and short and thicker roots with ectopic root hairs, similar to the ctr1 mutant. Moreover, the average area of the leaf epidermal cells was reduced 5-fold compared to wild type.
  • ebf1-2 ebf2-1  — ctr1-like phenotype (short hypocotyls, short roots, and exaggerated apical hooks).
  • ebf1-3 ebf2-3  — Strong growth arrest following germination even in the absence of ethylene. Plants fail to develop true leaves.
  • ebf1-3 ebf2-3 eil1-3  — Modest rescue of the ebf1-3 ebf2-3 phenotype. Seedlings continue grow and develop at a slow pace after germination. Cotyledons partially expanded and turned pale green. Stunted root densely covered with root hair. Plants never flowered or set seeds.
  • ebf1-3 ebf2-3 ein3-1  — More dramatic rescue of the ebf1-3 ebf2-3 phenotype. Seedlings grow rapidly after germination and eventually developed large rosette of true leaves. However the leaves are epinastic with elongated petioles and small leaf blades. Produced fertile but shorter flowers and viable seeds.
  • ebf1-3 ebf2-3 ein3-1 eil1-3  — Almost complete rescue of the ebf1-3 ebf2-3 phenotype. Plants are phenotypically indistinguishable from the wild type.
  • ebf2-1  — Flowering of the mutant is not significantly delayed.
  • ebf2-1  — The mutants were indistinguishable from wild-type under normal growth conditions. However, when germinated in the dark, all three mutant alleles showed a slightly exaggerated response to ACC. Nevertheless, striking developmental alterations resembling those of the ctr1 mutants were observed.

Literature:

Sequence:

cDNA Sequence
  • >AT5G25350.1 CTAGTGGATCATCCTTTTTAAAAATCGACATCTCTCAAATGTTTTTGTCAACAATGCATGTATTCTCTTCCTTCAATGTATTCAGTCTTTTTCGTCAAACCACATTTCAAAACTTTACGAATTTATTTTTATAATAATGTTTTTGATATGTTTCATTATAAATTAAAAATATGATGACAATTGGGTTCGGTGTGGGAACAAAGAAGGTGGAGAAGAAATCCGACTTTTTCGCGTGTATACATTGAACTTAAGAGTTTTTATCCTCTACATCAACTTCCACCGTACACCTCTCTCACCATTAAAGACGTTTCTCATTTTCTTCCTTGTTCTTCTCAATATCACAAACATTTCTTCTGTAAAAATCTTCTCTTTTTGCCCTAATCTTCTAGGGTTCTTCTTCTTTTCATGAATCTTAGTCTTCGATCTCTTCAAATCTTCGTCTTTCTTCTTCAAATCTTCTTCGAATTATGTCTGGAATCTTCAGATTTAGTGGTGATGAAGATTGTTTACTTGGGGGATCGATGTATCTATCACCAGGGAGCTGTCCCGGTGTATATTACCCAGCGCGTAAGAGGTTACGTGTTGCTGCGACGTCGTTTTACAGCGGTTTTGAGGAGAAGCAAACTTCAATCGATGTATTGCCTGAAGAGTGTTTATTTGAGATTCTAAGACGTTTACCTTCTGGACAAGAGAGGAGTGCTTGCGCTTGTGTTTCCAAGCATTGGCTTAATCTTTTGAGTAGTATCAGTAGGAGTGAAGTGAATGAGTCATCAGTTCAAGATGTGGAGGAGGGTGAAGGGTTTTTGTCTAGGAGTTTGGAGGGGAAGAAGGCGACGGATTTGAGGTTGGCGGCGATTGCGGTTGGGACGTCGAGTCGTGGTGGGTTGGGGAAGCTTCAGATTCGTGGGAGTGGGTTTGAGAGTAAGGTGACTGATGTTGGTCTTGGTGCTGTTGCTCATGGTTGTCCATCTCTTAGGATTGTTTCTTTATGGAACTTGCCTGCTGTTAGTGATTTGGGTTTGTCTGAGATCGCACGGTCATGCCCGATGATTGAAAAACTTGACCTTTCACGGTGTCCTGGAATAACTGACAGTGGATTGGTTGCTATTGCTGAGAACTGTGTGAATCTGAGTGATCTGACGATTGATTCTTGCTCTGGTGTTGGGAATGAGGGTTTAAGGGCTATTGCAAGACGTTGTGTCAATCTGAGATCTATCTCTATCAGGAGCTGCCCACGTATTGGTGATCAAGGTGTTGCCTTCCTCTTGGCTCAAGCTGGTTCTTACTTGACGAAAGTGAAACTCCAGATGCTGAACGTATCTGGTTTGTCTCTTGCTGTTATTGGTCACTACGGAGCAGCTGTTACTGATCTTGTGCTTCATGGACTTCAAGGTGTGAATGAGAAAGGCTTCTGGGTTATGGGAAATGCAAAAGGGTTGAAGAAACTGAAGTCCCTCTCAGTAATGTCGTGCAGAGGTATGACCGATGTTGGGCTCGAAGCTGTTGGAAATGGTTGCCCTGATCTGAAGCATGTCTCTCTGAACAAATGCTTGCTTGTTTCTGGTAAAGGACTTGTCGCTTTGGCCAAATCTGCATTGTCACTTGAAAGTTTGAAACTTGAAGAATGCCACAGGATCAACCAGTTTGGTCTTATGGGTTTTCTCATGAACTGTGGCTCAAAGTTGAAAGCTTTCTCTTTGGCAAACTGTCTGGGCATCAGTGACTTCAACTCAGAATCCTCTCTGCCATCACCCAGTTGCAGCTCTTTACGTTCTCTGTCAATCCGATGCTGCCCTGGGTTTGGGGATGCAAGTCTCGCTTTCTTGGGAAAGTTCTGTCATCAGCTTCAGGATGTTGAACTCTGTGGACTAAACGGAGTGACAGATGCAGGTGTGCGCGAGTTGCTACAGAGCAACAATGTTGGTCTAGTGAAGGTGAACCTGAGCGAATGTATCAATGTTTCAGACAACACAGTCTCTGCAATTTCTGTTTGCCACGGACGCACATTGGAGTCTCTTAACCTTGACGGCTGCAAGAACATCACAAACGCAAGCCTTGTCGCAGTAGCCAAGAACTGCTACTCAGTCAATGACCTTGACATCTCAAATACTTTGGTCTCAGATCACGGAATCAAGGCCTTGGCATCTTCTCCTAACCATCTGAATCTTCAGGTTCTTTCCATTGGCGGCTGCTCCTCAATTACAGACAAAAGCAAGGCATGCATACAAAAACTCGGCCGCACGCTTTTGGGATTAAACATCCAACGTTGTGGCAGAATCAGCAGCAGCACTGTGGATACTCTTCTCGAAAATCTATGGAGGTGCGATATACTCTACTAAATTCCCACTTTTTCTACAAAACCTTAGTATCATCATCATCAGTCCAAGTCTTTTTCCTAGGTTTTGGTCGCTAAAACCCATAGATTCCACCTAGAACTTAGTTTCTTTCTCAGGACACTGCAGTTGTTTTTTAAAATTTTTGGCAGGTTCCTTCTAAACAAAGGAGCCTGTTTCTACAACTGTTAGTGTTTTTGTGAAGCCTGTCACTGAGTTCTGGTAATCTAGTTTAGGGTTTAGTCTTGACCGTCTTTTTGGAGTTGTTGTCTCTCTATGTTCAGTAAAGTTCTTGTAGAAGTCATTTGTTCTTTGGTTTAGGTTCGTGATAGTGCCTTTTATCTTCTTCCACTGTAGAGCTTTTGGCAATGGCGGTGTAACTTCTTAATCCGCCATTACAACTCTTCGGAGTTGTTTTTTTGTGTGTTATGTATCTGCCAAAAGCTCTGTTTTTTCCCACTTTTTTGTTTAAGGCACTATCTTGTACTTATGAATCATTGTAACTTTGTACTCTCTATTATAAAGCTTTCACTGAACATAATTACTACCCTTTGTAATAGAACTTGATCCTTACATAATTGGATCATTTTGTTGTG
CDS Sequence
Protein Sequence