Gene Details:
- Gene ID: AT5G27960
- Gene Symbol: AGL90
- Gene Name: AGAMOUS-like 90
- Description: AGAMOUS-like 90;(source:Araport11)
- TAIR Accession: locus:2143769
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0006355 — acts upstream of or within — regulation of DNA-templated transcription
- GO:0045944 — involved in — positive regulation of transcription by RNA polymerase II
- GO:0000978 — enables — RNA polymerase II cis-regulatory region sequence-specific DNA binding
- GO:0005634 — located in — nucleus
- GO:0000981 — enables — DNA-binding transcription factor activity, RNA polymerase II-specific
- GO:0006357 — involved in — regulation of transcription by RNA polymerase II
- GO:0046983 — enables — protein dimerization activity
- GO:0003700 — enables — DNA-binding transcription factor activity
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Genomewide structural annotation and evolutionary analysis of the type I MADS-box genes in plants. DOI: 10.1007/s00239-002-2426-x ; PMID: 12698294
- The FHY3 and FAR1 genes encode transposase-related proteins involved in regulation of gene expression by the phytochrome A-signaling pathway. DOI: 10.1046/j.1365-313x.2003.01741.x ; PMID: 12753585
- Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: new openings to the MADS world. DOI: 10.1105/tpc.011544 ; PMID: 12837945
- Unexpected protein families including cell defense components feature in the N-myristoylome of a higher eukaryote. DOI: 10.1074/jbc.M307321200 ; PMID: 12912986
- Evolution and divergence of the MADS-box gene family based on genome-wide expression analyses. DOI: 10.1093/molbev/msg216 ; PMID: 12949148
- Expression of MADS-box genes during the embryonic phase in Arabidopsis. DOI: 10.1007/s11103-005-4546-3 ; PMID: 16028119
- Dosage-dependent deregulation of an AGAMOUS-LIKE gene cluster contributes to interspecific incompatibility. DOI: 10.1016/j.cub.2009.05.068 ; PMID: 19559614
- An atlas of type I MADS box gene expression during female gametophyte and seed development in Arabidopsis. DOI: 10.1104/pp.110.160770 ; PMID: 20631316
- FERTILIZATION-INDEPENDENT SEED-Polycomb Repressive Complex 2 Plays a Dual Role in Regulating Type I MADS-Box Genes in Early Endosperm Development. DOI: 10.1104/pp.17.00534 ; PMID: 29523711
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Unexpected protein families including cell defense components feature in the N-myristoylome of a higher eukaryote. DOI: 10.1074/jbc.M307321200 ; PMID: 12912986
Sequence:
cDNA Sequence
- >AT5G27960.1 ATGAAGAAGGTAAAGCTATCTTTGATAGCTAATGAAAGATCAAGGAAAACATCCTTCATGAAGAGGAAAAACGGGATATTCAAGAAACTCCACGAGTTGTCAACTCTATGTGGTGTCCAAGCTTGTGCTCTCATCTATAGTCCATTCATACCGGTTCCAGAGTCATGGCCGTCAAGGGAAGGTGCTAAAAAGGTAGCTTCAAAGTTTCTGGAGATGCCGCGGACAGCCCGAACCAGGAAGATGATGGATCAAGAAACCCATCTTATGGAGAGGATTACCAAAGCAAAAGAGCAACTAAAGAATTTGGCTGCTGAGAACCGAGAATTACAGGTTAGACGATTTATGTTTGATTGTGTTGAAGGCAAAATGTCCCAGTATCGTTATGATGCAAAAGACCTTCAAGATTTGCTATCTTGTATGAATCTATATCTCGATCAGCTTAACGGAAGGATCGAGTCCATTAAAGAAAACGGTGAGTCGTTGTTGTCTTCCGTCTCTCCTTTTCCTACTAGAATTGGTGTTGACGAAATTGGTGATGAGTCGTTTTCCGACTCTCCTATTCATTCTACAACTAGGGTTGTAGATACTCCTAATGCTACCAATCCTCATGTTCTTGCGGGCGATATGACTCCTTTTCTTGATGCGGACGCAAATGCGAATATGAATCAGGTTCAATACCAGGCTCCTAATAATCTGTTTAATCAGATTCAACGAGAATTCTACAACATAAATTTGAATCTGAATTTGAATCTGAATTCAAATCAGTATCTGAATCAACAACAATCATTCATGAATCCGATGGTGGAACAACATATGAATCATGTTGGAGGGCGTGAAAGCATTCCTTTCGTGGACAGAAACTACTACAACTACAATCAACTACCAGCCGTTGATCTTGCTTCCACCAGTTACATGCCTTCAACCACCGATGTTTATGATCCTTACATCAACAACAATCTCTAA
CDS Sequence
Protein Sequence