Gene Details:
- Gene ID: AT5G28060
- Gene Symbol: eS24y, RPS24B
- Gene Name: Ribosomal Protein eS24y
- Description: Ribosomal protein S24e family protein;(source:Araport11)
- TAIR Accession: locus:2143784
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0022626 — located in — cytosolic ribosome
- GO:0009505 — located in — plant-type cell wall
- GO:0016070 — acts upstream of or within — RNA metabolic process
- GO:0009536 — located in — plastid
- GO:0022627 — located in — cytosolic small ribosomal subunit
- GO:0006412 — involved in — translation
- GO:0003729 — enables — mRNA binding
- GO:0005737 — located in — cytoplasm
- GO:0003002 — acts upstream of or within — regionalization
Germplasm Phenotype:
- SALK_000766 — Delayed leaf development.
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Coordination of nuclear and mitochondrial genome expression during mitochondrial biogenesis in Arabidopsis. DOI: 10.1105/tpc.104.030254 ; PMID: 15829605
- The Arabidopsis thaliana transcriptome in response to Agrobacterium tumefaciens. DOI: 10.1094/MPMI-19-0665 ; PMID: 16776300
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- Balance between Cytosolic and Chloroplast Translation Affects Leaf Variegation. DOI: 10.1104/pp.17.00673 ; PMID: 29142022
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
Sequence:
cDNA Sequence
- >AT5G28060.1 ATAAATAATCTAGGGTTTAGTGTGCTCCTCCTTCCAAAGCCGCTGCGAAACTCGTCGATTTTCAAAACCGGAGCTCAGAGACTGATCTCGGAAAGTAAATCGCAGCCATGGCGGAAAAAGCTGTCACTATCAGGACCAGAAACTTCATGACCAACAGGCTTCTCGCCAGAAAGCAATTCGTTATTGATGTTCTTCATCCTGGAAGAGCCAATGTTTCAAAGGCTGAGCTTAAGGAGAAATTGGCGAGGATGTATGAGGTTAAGGACCCAAATGCTATCTTCTGTTTCAAGTTCAGAACTCACTTTGGAGGTGGTAAATCTTCTGGATATGGTTTGATCTATGATACTGTCGAGAACGCTAAGAAGTTTGAGCCTAAGTACAGACTTATCAGGAATGGACTTGACACCAAGATTGAGAAATCAAGGAAACAGATCAAGGAGAGGAAGAACAGGGCGAAGAAGATCCGTGGTGTTAAGAAGACCAAGGCTGGTGATACCAAGAAGAAGTAAGACGTTTGAAGAGGACAAAAGCAGCAATATGGTTTTTGTTCTGCATCACTCCTTCTTTGAAGCCATGTTTGCTATTAGACATCTTCTAATTATTTCTCGATTTTGTGCTTCTTTTTGTCACACTTGCTCTATTTTGGTTTGGATCTTGTTTTAGAGAAACATGTGGTTAAGATTTTGTTTGAATACATTGATTTTAAACTTCATCCTCTTGCGTTTCGGAGATTGAGACTATTGTTCAACTTTTCAATTTTTGCTACCACATACCACAAGATTAAAAGTTGGATTCTACTTGAAATTCATTAGTTGTCATGAGAATAAAGAAAAAAAGACTACGTTCTGGTTTCACAGGGG
CDS Sequence
Protein Sequence