Gene Details:
- Gene ID: AT5G35530
- Gene Symbol: uS3x
- Gene Name: Ribosomal Protein uS3x
- Description: Ribosomal protein S3 family protein;(source:Araport11)
- TAIR Accession: locus:2169518
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Gene Ontology:
- GO:0003729 — enables — mRNA binding
- GO:0006412 — involved in — translation
- GO:0022626 — located in — cytosolic ribosome
- GO:0009506 — located in — plasmodesma
- GO:0005634 — is active in — nucleus
- GO:0022627 — located in — cytosolic small ribosomal subunit
- GO:0005730 — located in — nucleolus
- GO:0003735 — enables — structural constituent of ribosome
- GO:0009536 — located in — plastid
- GO:0022627 — part of — cytosolic small ribosomal subunit
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- Versatile gene-specific sequence tags for Arabidopsis functional genomics: transcript profiling and reverse genetics applications. DOI: 10.1101/gr.2544504 ; PMID: 15489341
- Analysis of detergent-resistant membranes in Arabidopsis. Evidence for plasma membrane lipid rafts. DOI: 10.1104/pp.104.053041 ; PMID: 15618420
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Intergenic and genic sequence lengths have opposite relationships with respect to gene expression. DOI: 10.1371/journal.pone.0003670 ; PMID: 18989364
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- Identification of novel candidate phosphatidic acid-binding proteins involved in the salt-stress response of Arabidopsis thaliana roots. DOI: 10.1042/BJ20121639 ; PMID: 23323832
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. DOI: 10.1091/mbc.e04-09-0791 ; PMID: 15496452
- Analysis of detergent-resistant membranes in Arabidopsis. Evidence for plasma membrane lipid rafts. DOI: 10.1104/pp.104.053041 ; PMID: 15618420
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Comparative proteomic analysis of NaCl stress-responsive proteins in Arabidopsis roots. DOI: 10.1093/jxb/erm207 ; PMID: 17916636
Sequence:
cDNA Sequence
- >AT5G35530.1 ATTTAACCACACAATTTTATCATTTCACTCCTAACGCACTCTCTTCTCCGAATCTAGGGTTTTTGTCTCTAGCCTCCTCAAGCTTTGCAAACAATCATGGCGACCCAGATCAGCAAGAAGAGAAAGTTCGTAGCCGATGGTGTGTTTTACGCTGAACTCAATGAGGTTCTAACCAGAGAGCTTGCTGAGGATGGTTACTCTGGTGTTGAGGTTCGCGTCACTCCTATGCGTACTGAGATCATCATTAGAGCCACTCGTACTCAAAACGTTCTCGGTGAGAAGGGAAGGAGGATTAGGGAATTGACATCTCTTGTACAAAAGAGATTCAAATTTCCTCAGGACAGTGTTGAGCTTTATGCTGAGAAGGTTGCTAACAGAGGTCTTTGTGCTATTGCTCAGGCTGAGTCTCTTCGTTACAAGCTTCTTGGTGGTCTTGCTGTTCGTAGGGCGTGCTATGGTGTTTTAAGGTTTGTTATGGAGAGTGGAGCTAAAGGATGCGAAGTCATTGTGAGTGGAAAACTCCGTGCTGCACGTGCTAAGTCGATGAAGTTCAAGGATGGTTACATGGTTTCCTCAGGTCAGCCAACCAAGGAATACATTGATGCTGCAGTTAGGCATGTTCTTCTTAGACAGGGTGTGCTTGGTCTCAAGGTGAAGATCATGCTTGACTGGGACCCCAAGGGCAAACAAGGACCGATGACACCATTGCCTGATGTTGTGATCATCCATACACCGAAAGAAGATGATGTATACATTGCACCTGCTCAGGTTGTTACTCAAGCTGCTTTTGTACCGGAAGCTCCATTAACCACCACAGATTATCCAGCAATGCCAGTTGCTTAGAGAGCCTTTTCGTTTTCTGGTTTAAAACCCAATGGGGATGGTTCTTTTTTTGGGACAGTACTAGTTTTCTCATGTTATTCTAAGTTAATACTTAAAGTTCTGGAGGTTGAATTACATCAAGGATATGAATGTATGTTTTTCGTTATCTTTTGTTTAAATTTTATTTATCTATTAACGATTTGTCTTTTTTTAATTAGAAAATTTGTGTTTATCGACACCAAGATCTTGCTTGTGGCATGTTGATAACTAGCTTATGTCTCCGAGTTCCTGTGAATCTATCTTCAAACTTTTTTTCTTATCCTTACAATTGCATGTCTATAGCGTCAAAT
CDS Sequence
Protein Sequence