Gene Details:
- Gene ID: AT5G37640
- Gene Symbol: UBQ9
- Gene Name: ubiquitin 9
- Description: ubiquitin 9;(source:Araport11)
- TAIR Accession: locus:2151774
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0009536 — located in — plastid
- GO:0006511 — acts upstream of or within — ubiquitin-dependent protein catabolic process
- GO:0019941 — involved in — modification-dependent protein catabolic process
- GO:0005737 — is active in — cytoplasm
- GO:0031625 — enables — ubiquitin protein ligase binding
- GO:0031386 — enables — protein tag activity
- GO:0000325 — located in — plant-type vacuole
- GO:0009505 — located in — plant-type cell wall
- GO:0003729 — enables — mRNA binding
- GO:0005634 — is active in — nucleus
- GO:0005622 — located in — intracellular anatomical structure
- GO:0005730 — located in — nucleolus
Literature:
- Structure and evolution of genes encoding polyubiquitin and ubiquitin-like proteins in Arabidopsis thaliana ecotype Columbia. DOI: 10.1093/genetics/139.2.921 ; PMID: 7713442
- Recent stable insertion of mitochondrial DNA into an Arabidopsis polyubiquitin gene by nonhomologous recombination. DOI: 10.1105/tpc.5.1.97 ; PMID: 8382544
- Ubiquitylation in plants: a post-genomic look at a post-translational modification. DOI: 10.1016/s1360-1385(01)02080-5 ; PMID: 11590065
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- Identifying novel fruit-related genes in Arabidopsis thaliana based on the random walk with restart algorithm. DOI: 10.1371/journal.pone.0177017 ; PMID: 28472169
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. DOI: 10.1091/mbc.e04-09-0791 ; PMID: 15496452
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
Sequence:
cDNA Sequence
- >AT5G37640.1 ATGTCGATGCAAATTCACGCAAAGACTCTCACAGAAAAGACCATAACCATTGACGTTGTAAGCTCCGACACCATCAATAATGTCAAAGCAAAGATCCAGGACATAGAAGGGATTCCTCTAGACCAGCAAAGACTCATCTTTTCCGGTAAACTGCTAGATGATGGCCGTACTTTGGCCGATTACAGTATCCAAAAAGATTCAATACTCCACTTAGCTCTCAGGTTGAGAGGTGGTATGCAGATATTTGTCAAGACGCTTACCGGTAAAACCATTACCCTTGAAGTTGAGAGTTCAGACACTATTGACAATGTTAAAGCTAAGATCCAAGACAAGGAAGGAGTCCCTCCGGATCAACAGAGACTAATCTTTGCTGGTAAACAGCTTGACGATGGTCGCACTCTTGCAGATTACAACATCCAGAAAGAATCAACTCTCCACTTGGTTCTCAGGTTGAGAGGTGGTATGCAGATTTTTGTCAGGACACTTACCCGAAAAACCATAGCTTTGGAAGTTGAGAGCTCTGACACAACCGATAATGTGAAGGCCAAGATACAAGACAAAGAAGGGATCCCACCAGACCAACAGAGACTTATCTTTGCAGGCAAACAACTCGAAGATGGTCGGACGCTTGCTGATTACAACATCCAGAAGGAGTCAACACTTCATCTCGTGCTGCGTCTTTGTGGTGGGATGCAGATATTTGTCAACACTTTGACGGGAAAGACCATCACACTTGAAGTGGAGAGCTCTGATACGATTGACAATGTGAAGGCCAAGATTCAGGACAAAGAAAGGATCCAACCGGACCAACAGAGGCTAATCTTTGCAGGCGAGCAGCTTGAAGATGGTTATTACACTTTAGCGGATTACAATATCCAGAAAGAGTCAACTCTTCACCTTGTTCTCCGTCTCCGCGGTGGAGAGTGCTTTGGTTTTATTTTTCTTTTCTTGTTATGTTTTAACTCTTGA
CDS Sequence
Protein Sequence