Gene Details:
- Gene ID: AT5G37670
- Gene Symbol: HSP15.7
- Gene Name:
- Description: HSP20-like chaperones superfamily protein;(source:Araport11)
- TAIR Accession: locus:2151719
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Gene Ontology:
- GO:0000302 — involved in — response to reactive oxygen species
- GO:0042542 — involved in — response to hydrogen peroxide
- GO:0009651 — involved in — response to salt stress
- GO:0071456 — acts upstream of or within — cellular response to hypoxia
- GO:0005737 — located in — cytoplasm
- GO:0051259 — involved in — protein complex oligomerization
- GO:0006457 — involved in — protein folding
- GO:0043621 — enables — protein self-association
- GO:0009408 — involved in — response to heat
- GO:0005782 — located in — peroxisomal matrix
- GO:0051082 — enables — unfolded protein binding
Function-related keywords:
Literature:
- When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress. DOI: 10.1104/pp.103.033431 ; PMID: 15047901
- AraPerox. A database of putative Arabidopsis proteins from plant peroxisomes. DOI: 10.1104/pp.104.043695 ; PMID: 15333753
- DNA array analyses of Arabidopsis thaliana lacking a vacuolar Na+/H+ antiporter: impact of AtNHX1 on gene expression. DOI: 10.1111/j.1365-313X.2004.02253.x ; PMID: 15546358
- 12-oxo-phytodienoic acid triggers expression of a distinct set of genes and plays a role in wound-induced gene expression in Arabidopsis. DOI: 10.1104/pp.105.067058 ; PMID: 16258017
- Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. DOI: 10.1111/j.1365-313X.2006.02889.x ; PMID: 17059409
- A heat-inducible transcription factor, HsfA2, is required for extension of acquired thermotolerance in Arabidopsis. DOI: 10.1104/pp.106.091322 ; PMID: 17085506
- The AtHSP17.4C1 Gene Expression Is Mediated by Diverse Signals that Link Biotic and Abiotic Stress Factors with ROS and Can Be a Useful Molecular Marker for Oxidative Stress. DOI: 10.3390/ijms20133201 ; PMID: 31261879
- Integrative Analysis from the Epigenome to Translatome Uncovers Patterns of Dominant Nuclear Regulation during Transient Stress. DOI: 10.1105/tpc.19.00463 ; PMID: 31519798
- Identification and characterization of a stress-inducible and a constitutive small heat-shock protein targeted to the matrix of plant peroxisomes. DOI: 10.1104/pp.105.073841 ; PMID: 16531488
Sequence:
cDNA Sequence
- >AT5G37670.1 AACAGATAAAGATAAAAGGCCCAAATAATCACAAAAATCCTAGAATCGCATCGAACGGTTAGAATCAATCGATATCCATCATATCAATATACACTGCACCGTAGCATATAACAACCCCCTGGGCTTCTCCAAAGTTCTGGAGTCAGAGAAAATGAAGAAGAAACAAGATAACGAAGAACTGTCTCGACTTCTGTAATCTGTATAAAATACTTTCCACTCAAACATATATACACATCTCTAGAAAACAAGCTTAGCTAAAGAAGAAAGATAGAAGAATATGGCAGACAGAGGAATATTCTTGTATCCATTTAGAAGATTCCAAGAATGGTCAAGATCAACGGCTCTGATTGATTGGATGGAATCAAACAACTCTCATATCTTCAAGATCAACGTTCCTGGTTACAACAAAGAAGACATCAAAGTACAGATTGAAGAAGGGAATGTTTTGAGTATAAGAGGAGAAGGAATAAAGGAAGAGAAGAAGGAGAATTTGGTGTGGCACGTGGCGGAGAGAGAAGCTTTTTCCGGTGGTGGAAGTGAGTTTTTGCGGCGGATTGAGTTGCCGGAGAATGTGAAAGTTGATCAAGTTAAAGCTTACGTGGAGAATGGTGTTCTTACAGTTGTTGTTCCTAAGGACACTTCATCGAAATCGTCTAAAGTTAGGAATGTTAATATTACTAGCAAGCTTTGATGTCTAAACCGGGTTAAACCGGTTTTTGGTTTTCTTAAGATGAATAAAATTGGACTTTGTTATTTCATAAATCTAATGAATTGCAGTATGCCAGTATGTAATATTTAGGAATCCAATAAGATGTTAATATTACTAGCAAGCTT
CDS Sequence
Protein Sequence