Gene Details:
- Gene ID: AT5G38420
- Gene Symbol: DEG24, RBCS2B
- Gene Name: Rubisco small subunit 2B
- Description: Ribulose bisphosphate carboxylase (small chain) family protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- PathMAPA: a tool for displaying gene expression and performing statistical tests on metabolic pathways at multiple levels for Arabidopsis. DOI: 10.1186/1471-2105-4-56 ; PMID: 14604444
- Maximizing the efficacy of SAGE analysis identifies novel transcripts in Arabidopsis. DOI: 10.1104/pp.104.043406 ; PMID: 15489285
- Transcriptional similarities, dissimilarities, and conservation of cis-elements in duplicated genes of Arabidopsis. DOI: 10.1104/pp.104.046466 ; PMID: 15489284
- Analysis of 101 nuclear transcriptomes reveals 23 distinct regulons and their relationship to metabolism, chromosomal gene distribution and co-ordination of nuclear and plastid gene expression. DOI: 10.1016/j.gene.2004.09.009 ; PMID: 15656970
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Comparative analyses of the gene expression profiles of Arabidopsis intact plant and cultured cells. DOI: 10.1007/s10529-005-8456-x ; PMID: 16132859
- Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays. DOI: 10.1007/s10142-005-0014-z ; PMID: 16463051
- The heavy metal hyperaccumulator Thlaspi caerulescens expresses many species-specific genes, as identified by comparative expressed sequence tag analysis. DOI: 10.1111/j.1469-8137.2006.01714.x ; PMID: 16684236
- Characterization of an Arabidopsis thaliana mutant lacking a cytosolic non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase. DOI: 10.1007/s11103-006-0060-5 ; PMID: 16927206
- The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show and long-term exposure to low temperature. DOI: 10.1111/j.1365-313X.2006.02821.x ; PMID: 16923014
- Alternative and effective proteomic analysis in Arabidopsis. DOI: 10.1002/pmic.200700346 ; PMID: 17828791
- Recent advances in plant cell wall proteomics. DOI: 10.1002/pmic.200700938 ; PMID: 18210371
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Integrative analyses of genetic variation in enzyme activities of primary carbohydrate metabolism reveal distinct modes of regulation in Arabidopsis thaliana. DOI: 10.1186/gb-2008-9-8-r129 ; PMID: 18710526
- Unique and overlapping expression patterns among members of photosynthesis-associated nuclear gene families in Arabidopsis. DOI: 10.1104/pp.108.126946 ; PMID: 18820083
- RBCS1A and RBCS3B, two major members within the Arabidopsis RBCS multigene family, function to yield sufficient Rubisco content for leaf photosynthetic capacity. DOI: 10.1093/jxb/err434 ; PMID: 22223809
- Arabidopsis Pol II-Dependent in Vitro Transcription System Reveals Role of Chromatin for Light-Inducible rbcS Gene Transcription. DOI: 10.1104/pp.15.01614 ; PMID: 26662274
- Structure of Rubisco from Arabidopsis thaliana in complex with 2-carboxyarabinitol-1,5-bisphosphate. DOI: 10.1107/S2059798317017132 ; PMID: 29372894
- OXS2 is Required for Salt Tolerance Mainly through Associating with Salt Inducible Genes, CA1 and Araport11, in Arabidopsis. DOI: 10.1038/s41598-019-56456-1 ; PMID: 31889067
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Chloroplast Protein Tic55 Involved in Dark-Induced Senescence through AtbHLH/AtWRKY-ANAC003 Controlling Pathway of Arabidopsis thaliana. DOI: 10.3390/genes13020308 ; PMID: 35205352
- Proteomic study of the Arabidopsis thaliana chloroplastic envelope membrane utilizing alternatives to traditional two-dimensional electrophoresis. DOI: 10.1021/pr034025j ; PMID: 12938931
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- High light response of the thylakoid proteome in arabidopsis wild type and the ascorbate-deficient mutant vtc2-2. A comparative proteomics study. DOI: 10.1104/pp.106.080150 ; PMID: 16648217
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. DOI: 10.1016/j.phytochem.2008.04.007 ; PMID: 18538804
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequence:
cDNA Sequence
- >AT5G38420.1 GCGGTTCCCACTATATAAAGATGACAAAACCAACAGACAAACAAGTAAGTAAGAGAAAAACCAAAAGAAGAAGAGAAACAACAAGAAGAAGTAATGGCTTCCTCTATGTTCTCCTCCACCGCTGTGGTTACCTCCCCGGCTCAAGCCACCATGGTCGCTCCATTCACCGGCTTGAAGTCATCCGCTTCTTTCCCGGTCACCCGCAAGGCCAACAACGACATTACTTCCATCACAAGCAACGGAGGAAGAGTTAGCTGCATGAAGGTGTGGCCACCAATCGGAAAGAAGAAGTTTGAGACTCTATCTTACCTCCCTGACCTTAGTGACGTTGAATTGGCTAAGGAAGTTGACTACCTTCTCCGCAACAAGTGGATTCCTTGTGTTGAATTCGAGTTGGAGCACGGATTTGTGTACCGTGAGCACGGAAACACTCCCGGATACTATGATGGACGATACTGGACAATGTGGAAGCTTCCATTGTTCGGATGCACCGACTCCGCTCAAGTGTTGAAGGAAGTTGAAGAATGCAAGAAGGAGTACCCTGGCGCCTTCATTAGGATCATCGGATTCGACAACACCCGTCAAGTCCAATGCATCAGTTTCATTGCCTACAAGCCCCCAAGCTTCACCGAAGCTTAATCCCCTTTCTGGAATATTCAGCGTTGATTATTCTGGAACCCATTTCTATGTGGTCAATGCAAATTTAAGAAATTATTTGCCGACTTAACAGTTGAGGAACTATTGTTTGAAAGTGAAAATGTTATTCCTATCAGTTTCTCTATAATTATAGTTATCATTTCATTTCATTTTTGCCCTTAAATCTTTGAAATCTTATTTTTCGTTTAGCTCCTTTAAACAACATTGTGGCTCCTTTAAATTATCCTCATAATTCTTGCTTTTGACTCCCTAGACTAACCAATAAACTCTAATAAAAA
CDS Sequence
Protein Sequence