Gene Details:
- Gene ID: AT5G39510
- Gene Symbol: ATVTI11, ATVTI1A, ITT3, SGR4, VTI11, VTI1A, ZIG, ZIG1
- Gene Name: VESICLE TRANSPORT V-SNARE 11, IMPAIRED TONOPLAST TRAFFIC 3, SHOOT GRAVITROPSIM 4, VESICLE TRANSPORT V-SNARE 11, vesicle transport V-snare 1A
- Description: Vesicle transport v-SNARE family protein;(source:Araport11)
- TAIR Accession: locus:2175733
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Gene Ontology:
- GO:0000325 — located in — plant-type vacuole
- GO:0031201 — part of — SNARE complex
- GO:0006623 — acts upstream of or within — protein targeting to vacuole
Function-related keywords:
Literature:
- The plant vesicle-associated SNARE AtVTI1a likely mediates vesicle transport from the trans-Golgi network to the prevacuolar compartment. DOI: 10.1091/mbc.10.7.2251 ; PMID: 10397763
- Mutations in the SGR4, SGR5 and SGR6 loci of Arabidopsis thaliana alter the shoot gravitropism. DOI: 10.1093/oxfordjournals.pcp.a029201 ; PMID: 9210330
- The Arabidopsis genome. An abundance of soluble N-ethylmaleimide-sensitive factor adaptor protein receptors. DOI: 10.1104/pp.124.4.1558 ; PMID: 11115874
- SGR2, a phospholipase-like protein, and ZIG/SGR4, a SNARE, are involved in the shoot gravitropism of Arabidopsis. DOI: 10.1105/tpc.010215 ; PMID: 11826297
- Conversion of functional specificity in Qb-SNARE VTI1 homologues of Arabidopsis. DOI: 10.1016/j.cub.2005.02.021 ; PMID: 15797025
- Mapping the Arabidopsis organelle proteome. DOI: 10.1073/pnas.0506958103 ; PMID: 16618929
- Arabidopsis EPSIN1 plays an important role in vacuolar trafficking of soluble cargo proteins in plant cells via interactions with clathrin, AP-1, VTI11, and VSR1. DOI: 10.1105/tpc.105.039123 ; PMID: 16905657
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- A SNARE complex unique to seed plants is required for protein storage vacuole biogenesis and seed development of Arabidopsis thaliana. DOI: 10.1105/tpc.107.057711 ; PMID: 18984676
- Vacuolar SNAREs function in the formation of the leaf vascular network by regulating auxin distribution. DOI: 10.1093/pcp/pcp076 ; PMID: 19493960
- ZIP genes encode proteins involved in membrane trafficking of the TGN-PVC/vacuoles. DOI: 10.1093/pcp/pcp137 ; PMID: 19884248
- Loss-of-function mutations of retromer large subunit genes suppress the phenotype of an Arabidopsis zig mutant that lacks Qb-SNARE VTI11. DOI: 10.1105/tpc.109.069294 ; PMID: 20086190
- An Arabidopsis E3 ligase, SHOOT GRAVITROPISM9, modulates the interaction between statoliths and F-actin in gravity sensing. DOI: 10.1105/tpc.110.079442 ; PMID: 21602290
- Identification of imprinted genes subject to parent-of-origin specific expression in Arabidopsis thaliana seeds. DOI: 10.1186/1471-2229-11-113 ; PMID: 21838868
- Myrosin cell development is regulated by endocytosis machinery and PIN1 polarity in leaf primordia of Arabidopsis thaliana. DOI: 10.1105/tpc.114.131441 ; PMID: 25428982
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- AtNHX5 and AtNHX6 Are Required for the Subcellular Localization of the SNARE Complex That Mediates the Trafficking of Seed Storage Proteins in Arabidopsis. DOI: 10.1371/journal.pone.0151658 ; PMID: 26986836
- Plant vacuolar trafficking occurs through distinctly regulated pathways. DOI: 10.1016/j.cub.2014.05.004 ; PMID: 24881878
- SCYL2 Genes Are Involved in Clathrin-Mediated Vesicle Trafficking and Essential for Plant Growth. DOI: 10.1104/pp.17.00824 ; PMID: 28751315
- Auxin and ROP GTPase Signaling of Polar Nuclear Migration in Root Epidermal Hair Cells. DOI: 10.1104/pp.17.00713 ; PMID: 29084900
- Phosphoinositides control the localization of HOPS subunit VPS41, which together with VPS33 mediates vacuole fusion in plants. DOI: 10.1073/pnas.1807763115 ; PMID: 30104351
- Dual-Reporting Transcriptionally Linked Genetically Encoded Fluorescent Indicators Resolve the Spatiotemporal Coordination of Cytosolic Abscisic Acid and Second Messenger Dynamics in Arabidopsis. DOI: 10.1105/tpc.19.00892 ; PMID: 32471862
- The Arabidopsis R-SNARE protein YKT61 is essential for gametophyte development. DOI: 10.1111/jipb.13017 ; PMID: 32918784
- SNAREs Regulate Vesicle Trafficking During Root Growth and Development. DOI: 10.3389/fpls.2022.853251 ; PMID: 35360325
- AtVPS45 complex formation at the trans-Golgi network. DOI: 10.1091/mbc.11.7.2251 ; PMID: 10888666
- Mutations in the SGR4, SGR5 and SGR6 loci of Arabidopsis thaliana alter the shoot gravitropism. DOI: 10.1093/oxfordjournals.pcp.a029201 ; PMID: 9210330
- The Arabidopsis genome. An abundance of soluble N-ethylmaleimide-sensitive factor adaptor protein receptors. DOI: 10.1104/pp.124.4.1558 ; PMID: 11115874
- Role of endodermal cell vacuoles in shoot gravitropism. DOI: 10.1007/s003440010047 ; PMID: 12024223
- Involvement of the vacuoles of the endodermis in the early process of shoot gravitropism in Arabidopsis. DOI: 10.1105/tpc.010216 ; PMID: 11826298
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- Mapping the Arabidopsis organelle proteome. DOI: 10.1073/pnas.0506958103 ; PMID: 16618929
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Divergent functions of VTI12 and VTI11 in trafficking to storage and lytic vacuoles in Arabidopsis. DOI: 10.1073/pnas.0611147104 ; PMID: 17360696
- Analysis of the Arabidopsis cytosolic proteome highlights subcellular partitioning of central plant metabolism. DOI: 10.1021/pr1009433 ; PMID: 21166475
Sequence:
cDNA Sequence
- >AT5G39510.1 GAAGAGTCTTTTCGCAACACCAAAAATGGCAGATCCGCAAGCCCAACAAGGCAGTGGCATTGCCAAAAGATCTGGACAAAAAAAAGGCCAAGTGGTGTACAAAGCCTAGATGTAGGATATAATTACTCAACCGTCGAACATATTTTCCATAGATCATTCATAGACGTACGCATCATCAAATCAATTCATCGTCGTCTTCCACAATTGTCATCACCGATCGATTTTCCGACTCCGACGTACCTCCTCTTCCCCGTTACCTTCTCAGAGTTTTTAGTAGTCTTCCTTTGGAACAATGAGTGACGTGTTTGATGGATATGAGCGACAATACTGTGAGCTCTCGGCGAGTCTTTCAAAGAAGTGTTCCTCTGCTATTTCGCTTGATGGAGAACAAAAGAAGCAGAAGTTGTCTGAAATAAAATCCGGGCTGGAAAATGCAGAAGTATTGATTAGGAAAATGGATCTCGAGGCAAGGACCCTTCCACCTAATCTTAAGTCCAGCCTCCTTGTCAAATTAAGAGAATTCAAGTCTGATCTGAACAATTTCAAAACTGAAGTGAAGAGAATCACATCTGGACAGTTGAACGCTGCTGCTCGTGATGAGTTGCTAGAAGCTGGTATGGCTGACACAAAGACGGCTTCAGCTGATCAGAGAGCAAGATTGATGATGTCAACTGAGCGTCTGGGCCGAACCACTGACAGAGTCAAGGACAGTCGTAGAACAATGATGGAGACTGAAGAAATCGGTGTTTCAATCCTCCAAGACTTGCACGGTCAGAGACAGTCTCTCTTACGTGCCCACGAAACGCTTCATGGAGTAGACGATAACATTGGAAAGAGCAAGAAGATCTTGACAGACATGACGAGGAGGATGAACAAGAACAAATGGACCATTGGAGCCATCATCATCGCATTGATTGCCGCCATTTTCATCATCTTGTACTTCAAACTCACCAAGTAAGCCTCTGTAACTAAATCCGACCAAATCAAAGAACAACGGTTGTTTTCGTTTTGTGAGTCTTTGATTTATCCTGTTTCTTCTTTTTGTGTGAAAAGTTGTTTTGCCACCTTTGTATTCTAAATTTGACCATACATACTTTAAGCAAGTAAAGCTTCGGCCTAAGTGTCACGTATATTGTTTATATTGTTCATATCAAATCCAGAACTATACATGGTTAAACATTGAGATTAAAAGCCTCAATTATTTCAA
CDS Sequence
Protein Sequence