Gene Details:
- Gene ID: AT5G39950
- Gene Symbol: ATH2, ATTRX2, ATTRXH2, TRX2, TRXH2
- Gene Name: Arabidopsis thioredoxin h2, thioredoxin 2, thioredoxin 2, THIOREDOXIN H2
- Description: thioredoxin 2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Function-related keywords:
Literature:
- Evidence for five divergent thioredoxin h sequences in Arabidopsis thaliana. DOI: 10.1073/pnas.92.12.5620 ; PMID: 7777559
- Cell cycle-regulated gene expression in Arabidopsis. DOI: 10.1074/jbc.M207570200 ; PMID: 12169696
- Unexpected protein families including cell defense components feature in the N-myristoylome of a higher eukaryote. DOI: 10.1074/jbc.M307321200 ; PMID: 12912986
- Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome. DOI: 10.1104/pp.103.028241 ; PMID: 14500793
- The plant thioredoxin system. DOI: 10.1007/s00018-004-4296-4 ; PMID: 15619004
- Phylogenetic analyses identify 10 classes of the protein disulfide isomerase family in plants, including single-domain protein disulfide isomerase-related proteins. DOI: 10.1104/pp.104.056507 ; PMID: 15684019
- Evolution of redoxin genes in the green lineage. DOI: 10.1007/s11120-006-9095-3 ; PMID: 17031546
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- A novel type of thioredoxin dedicated to symbiosis in legumes. DOI: 10.1104/pp.108.123778 ; PMID: 18614707
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Analysis of Arabidopsis thioredoxin-h isotypes identifies discrete domains that confer specific structural and functional properties. DOI: 10.1042/BJ20130618 ; PMID: 24003859
- Decreased Levels of Thioredoxin o1 Influences Stomatal Development and Aperture but Not Photosynthesis under Non-Stress and Saline Conditions. DOI: 10.3390/ijms22031063 ; PMID: 33494429
- Thioredoxin h2 and o1 Show Different Subcellular Localizations and Redox-Active Functions, and Are Extrachloroplastic Factors Influencing Photosynthetic Performance in Fluctuating Light. DOI: 10.3390/antiox10050705 ; PMID: 33946819
- Thioredoxins regulate the metabolic fluxes throughout the tricarboxylic acid cycle and associated pathways in a light-independent manner. DOI: 10.1016/j.plaphy.2022.10.022 ; PMID: 36323196
- Unexpected protein families including cell defense components feature in the N-myristoylome of a higher eukaryote. DOI: 10.1074/jbc.M307321200 ; PMID: 12912986
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
Sequence:
cDNA Sequence
- >AT5G39950.1 GCACGATGTTTGAATATTAAACGACACGATCGTTGACCAAAGAAAGCAGGGTCGTTCTTAAACGCAATCAGAGAGAGAAGCGAGACGAGAGACGATAATGGGAGGAGCTTTATCAACTGTGTTTGGAAGTGGAGAAGATGCAACAGCTGCAGGGACCGAATCTGAGCCAAGTCGCGTCCTAAAGTTTAGCTCTTCCGCTCGGTGGCAACTTCATTTCAACGAGATCAAAGAATCAAACAAACTGCTGGTGGTTGATTTCTCGGCCTCATGGTGCGGACCATGTAGGATGATTGAGCCTGCGATTCATGCCATGGCTGATAAGTTCAATGATGTTGATTTCGTCAAATTAGATGTTGATGAACTTCCTGATGTGGCTAAAGAGTTTAATGTGACGGCAATGCCTACCTTTGTGCTGGTGAAAAGGGGTAAAGAAATTGAAAGAATCATTGGTGCCAAAAAGGACGAACTTGAGAAGAAAGTTAGCAAACTCAGAGCATAATGAGCATTGTTAACGCCTTAACCAATAGTCTTGTGTAAACTCAATAATAAATGGTATGTTTATGGGGAATGTGATGTTCTATACTCTCTGCTAATGTAAGACCTTCTGTGTGATGCCATGATTGATTGAAATGGTTTGTTGAAATGCTTAGACTCTGCTTTCAGTGGTTTATGATACAAAGTTGACACCTTTTCAGCT
CDS Sequence
Protein Sequence