Gene Details:
- Gene ID: AT5G40420
- Gene Symbol: OLE2, OLEO2
- Gene Name: OLEOSIN 2, oleosin 2
- Description: oleosin 2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Literature:
- Cloning of a cDNA encoding the 21.2 kDa oleosin isoform from Arabidopsis thaliana and a study of its expression in a mutant defective in diacylglycerol acyltransferase activity. DOI: 10.1007/BF00021805 ; PMID: 8756608
- A novel group of oleosins is present inside the pollen of Arabidopsis. DOI: 10.1074/jbc.M109298200 ; PMID: 11929861
- Arabidopsis genes involved in acyl lipid metabolism. A 2003 census of the candidates, a study of the distribution of expressed sequence tags in organs, and a web-based database. DOI: 10.1104/pp.103.022988 ; PMID: 12805597
- Comparative analysis of expressed sequence tags from Sesamum indicum and Arabidopsis thaliana developing seeds. DOI: 10.1023/b:plan.0000004304.22770.e9 ; PMID: 14682612
- Impact of unusual fatty acid synthesis on futile cycling through beta-oxidation and on gene expression in transgenic plants. DOI: 10.1104/pp.103.032938 ; PMID: 14671017
- Protein composition of oil bodies in Arabidopsis thaliana ecotype WS. DOI: 10.1016/j.plaphy.2004.04.006 ; PMID: 15246063
- Leucine-rich repeat receptor-like kinase1 is a key membrane-bound regulator of abscisic acid early signaling in Arabidopsis. DOI: 10.1105/tpc.104.027474 ; PMID: 15772289
- Transcriptional profiling of imbibed Brassica napus seed. DOI: 10.1016/j.ygeno.2005.07.006 ; PMID: 16125897
- The zinc-finger protein Zat12 plays a central role in reactive oxygen and abiotic stress signaling in Arabidopsis. DOI: 10.1104/pp.105.068254 ; PMID: 16183833
- Characterization of a novel putative zinc finger gene MIF1: involvement in multiple hormonal regulation of Arabidopsis development. DOI: 10.1111/j.1365-313X.2005.02626.x ; PMID: 16412086
- Computational and experimental analysis identifies Arabidopsis genes specifically expressed during early seed development. DOI: 10.1186/1471-2164-7-38 ; PMID: 16504176
- Characterization and functional analysis of ABSCISIC ACID INSENSITIVE3-like genes from Physcomitrella patens. DOI: 10.1111/j.1365-313X.2006.02764.x ; PMID: 16805735
- Regulation and functional analysis of ZmDREB2A in response to drought and heat stresses in Zea mays L. DOI: 10.1111/j.1365-313X.2007.03034.x ; PMID: 17346263
- The SebHLH transcription factor mediates trans-activation of the SeFAD2 gene and G-box elements. DOI: 10.1007/s11103-007-9165-8 ; PMID: 17420955
- An Arabidopsis mutant able to green after extended dark periods shows decreased transcripts of seed protein genes and altered sensitivity to abscisic acid. DOI: 10.1093/jxb/ern227 ; PMID: 18931353
- Acyl-lipid metabolism. DOI: 10.1199/tab.0161 ; PMID: 23505340
- AtC3H17, a Non-Tandem CCCH Zinc Finger Protein, Functions as a Nuclear Transcriptional Activator and Has Pleiotropic Effects on Vegetative Development, Flowering and Seed Development in Arabidopsis. DOI: 10.1093/pcp/pcw013 ; PMID: 26858286
- PUX10 Is a CDC48A Adaptor Protein That Regulates the Extraction of Ubiquitinated Oleosins from Seed Lipid Droplets in Arabidopsis. DOI: 10.1105/tpc.18.00275 ; PMID: 30087208
- Identification of Low-Abundance Lipid Droplet Proteins in Seeds and Seedlings. DOI: 10.1104/pp.19.01255 ; PMID: 31826923
- Multiple caleosins have overlapping functions in oil accumulation and embryo development. DOI: 10.1093/jxb/erac153 ; PMID: 35419601
Sequence:
cDNA Sequence
- >AT5G40420.1 ATTACAAAGAAAATAGGTAAAAACAATTTCTCATTAGCTTACAATGGCGGATACACACCGTGTCGACCGTACTGATAGACACTTTCAATTTCAGTCGCCCTATGAAGGCGGCCGAGGTCAAGGTCAGTATGAAGGTGACCGTGGTTACGGTGGTGGCGGTTACAAGAGCATGATGCCTGAAAGTGGCCCATCTAGTACCCAAGTATTGTCCCTGTTGATTGGAGTCCCTGTCGTCGGTTCGCTACTTGCCTTGGCTGGATTACTTCTAGCTGGTTCGGTGATCGGCTTAATGGTTGCTTTACCACTATTTCTCCTCTTCAGCCCGGTTATAGTCCCAGCGGCTCTAACTATCGGGCTTGCAATGACAGGCTTTTTAGCCTCGGGGATGTTCGGTCTAACCGGGCTTAGCTCAATCTCATGGGTCATGAACTATCTTCGTGGGACAAGGAGAACTGTGCCTGAGCAATTGGAGTATGCTAAGAGGAGAATGGCTGATGCGGTTGGCTACGCAGGACAAAAGGGCAAAGAAATGGGCCAGCATGTGCAGAACAAGGCCCAAGATGTTAAACAATATGATATTTCTAAGCCACATGACACTACCACTAAGGGTCATGAGACTCAGGGGAGGACGACGGCTGCATGATGAGTTTTCAGTATGAACGGTAGATATGTGTTTTCACTATTATGTCGTTTTTTCTGCATTTTCAATATGATGTTATGTGTTTTTTTTGTTTGGCTTTTTGTTGAACCGTGTATGTGTTTTATGTTTTTGTAAGCATGAAAGATCGCAAGTGTTGTGGTAATATTTGAATGTAATAATATGATAAGTTGATAAATCATGGGAACATTTAAATTAGGTGGACATGTTTAGCTATTTGATACTCACAGTTCTTTAGGTTTCTAGTTTTTTTTTTGTCTATATAGA
CDS Sequence
Protein Sequence