Gene Details:
- Gene ID: AT5G40730
- Gene Symbol: AGP24, ATAGP24
- Gene Name: arabinogalactan protein 24, ARABIDOPSIS THALIANA ARABINOGALACTAN PROTEIN 24
- Description: arabinogalactan protein 24;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Function-related keywords:
Literature:
- Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis. DOI: 10.1104/pp.010884 ; PMID: 12068095
- Using genomic resources to guide research directions. The arabinogalactan protein gene family as a test case. DOI: 10.1104/pp.003459 ; PMID: 12177459
- Global identification of target genes regulated by APETALA3 and PISTILLATA floral homeotic gene action. DOI: 10.1105/tpc.006353 ; PMID: 12509532
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- SETH1 and SETH2, two components of the glycosylphosphatidylinositol anchor biosynthetic pathway, are required for pollen germination and tube growth in Arabidopsis. DOI: 10.1105/tpc.014407 ; PMID: 14671020
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- Post-translational modifications of arabinogalactan-peptides of Arabidopsis thaliana. Endoplasmic reticulum and glycosylphosphatidylinositol-anchor signal cleavage sites and hydroxylation of proline. DOI: 10.1074/jbc.M407594200 ; PMID: 15322080
- AtFLA11, a fasciclin-like arabinogalactan-protein, specifically localized in sclerenchyma cells. DOI: 10.1271/bbb.69.1963 ; PMID: 16244449
- Analysis of the female gametophyte transcriptome of Arabidopsis by comparative expression profiling. DOI: 10.1104/pp.105.067314 ; PMID: 16299181
- Overexpression of INFLORESCENCE DEFICIENT IN ABSCISSION activates cell separation in vestigial abscission zones in Arabidopsis. DOI: 10.1105/tpc.106.042036 ; PMID: 16679455
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Phenotypic screening of Arabidopsis T-DNA insertion lines for cell wall mechanical properties revealed ANTHOCYANINLESS2, a cell wall-related gene. DOI: 10.1016/j.jplph.2015.11.011 ; PMID: 26720211
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
Sequence:
cDNA Sequence
- >AT5G40730.1 ACAACAAACAACACAAATCTTTTTCTCATTCATCAAAAGAAAAAACCAAAGCAAAAAAAACTCAAAACGTTTTTGAAGATAATGATGATGATGACGAAGATGTTTGTTCAGATCGCTGTGGTTTGTCTATTGGCGACGATGGCCGTTGTGTCCGCCCACGAGGGTCACCACCACCATGCTCCGGCTCCAGCACCAGGACCCGCATCTAGCTCAACCGTTGTTTCGGCCACCAATATGTTCACCGTCTTGGCTATTGCTGCCGTGGCTCTCGTCGTTGGTTCCAACCACTAAGTTGGTTATTACATTCGTCGTTTTGTTTCGGTTTCTATGAAATTGTTCTCTTGACTTTTAATATATTTTGAATTTTTCTCATTTGTTTTTAACTCTCTCTATGTTGATCTGATTTCTTGAATAAAATAAAAGTTTATTGAACGTGTGTTTTTAATTACGAAGATTTGGATTACAAATCCGATTCTTAGTAACCGATGAAACCAACGTCTGTGTGTGTTTTTAGCTAGGAGATCTTCGAAAACAATTGTTTCCTTGTGAAAACAATGTTTTTTAATTTTACGAGACTAATCTATAATCTGCCAAGACCACTCGAAAAGTTCATCAACGCTTAGGTTATTGTTTTTAATGTGCATGAACAATTTTATTAGATAGAAGCAGCAGTATAT
CDS Sequence
Protein Sequence