Gene Details:
- Gene ID: AT5G40950
- Gene Symbol: bL27c, PRPL27, RPL27
- Gene Name: Ribosomal Protein bL27c, , ribosomal protein large subunit 27
- Description: ribosomal protein large subunit 27;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Function-related keywords:
Literature:
- Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis determined by experimentation and genome-wide prediction. DOI: 10.1105/tpc.010304 ; PMID: 11826309
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Comparative analysis of bacterial-origin genes for plant mitochondrial ribosomal proteins. DOI: 10.1093/molbev/msj080 ; PMID: 16368778
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Versatile roles of Arabidopsis plastid ribosomal proteins in plant growth and development. DOI: 10.1111/tpj.12000 ; PMID: 22900828
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- CHLOROPLAST RIBOSOME ASSOCIATED Supports Translation under Stress and Interacts with the Ribosomal 30S Subunit. DOI: 10.1104/pp.18.00602 ; PMID: 29914890
- Genome-wide identification of EMBRYO-DEFECTIVE (EMB) genes required for growth and development in Arabidopsis. DOI: 10.1111/nph.16071 ; PMID: 31334862
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis determined by experimentation and genome-wide prediction. DOI: 10.1105/tpc.010304 ; PMID: 11826309
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
Sequence:
cDNA Sequence
- >AT5G40950.1 AAGGAGAAGAACTTCTTCTTCAACCTCAGAAAACCCTAATTTCTCCATTTCGAAACTCCAACGAATTCTCTGGTGATTTTACCAATGGCGATGGCAACATCGATGAGTTTGAATCTAATTGGGGCATTCAAAGGCTTGTCTCTTTCTTCGACTTCGTCTTTTCTTAGAGGCGATTTGAGTTTTTCCCCCAAAACCTCTTTCACGGTGACTCTTCCTCTGGAAAATCTTCAAGCTCCGATTCCGTTGACAATTGAATCGGCCCATAAGAAAGGAGCTGGTAGCACCAAGAACGGTCGTGATTCTCCTGGGCAACGACTCGGCGTCAAGATCTACGGTGACCAAGTTGCTAAACCTGGTGCTATCATTGTTCGTCAACGTGGCACTAAGTTCCATGCTGGGAAAAATGTTGGGATTGGTAAAGATCATACCATCTTCTCTTTAATCGATGGATTAGTCAAGTTCGAGAAGTTTGGTCCTGACAGGAAGAAGATAAGTGTGTATCCAAGAGAAATTGTACCAGAGAATCCCAATAGCTACAGAGCAAGAAAGAGAGAAAACTTCAGATTGCAAAGGGAGAAGAAGAAGGCGAGACGCGAGAATTACTCGTACACACTTCCTACACCAGAACTTGTTCTTGCATCTGCCTCAGTCGATGATGCTGAAGCCAATCCGGAGTGCTAGAAGATTGAATGTGGAGTTTCCTTGTCTCTTTTTGTTTAGTCTTGTTTATGAAAAATGATCCTTTCAGAGTATTAAGAGTTGGTTGTATTGTCGAATCCAAGCCTCTCTTTTGTCAAATTGAGTCCCAAGCAGGCGGATTTTTACCCAACTTGAGTTATTAGTGTAATCAAATGGTTATTGTTAATTAGTCAAAGCCTCAAAGGTTTTAATTTAGTGAATTTCTCTTCCAACTTAGTAATTCTGAATCATTGATAAGAGAGACCACCAAA
CDS Sequence
Protein Sequence