Gene Details:
- Gene ID: AT5G42270
- Gene Symbol: FTSH5, VAR1
- Gene Name: VARIEGATED 1
- Description: FtsH extracellular protease family;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000003 — whole plant — planta entera (Spanish, exact), 植物体全体 (Japanese, exact), clonal colony (related), colony (related), bush (narrow), frutex (narrow), frutices (narrow), gametophyte (narrow), herb (narrow), liana (narrow), prothalli (narrow), prothallium (narrow), prothallus (narrow), seedling (narrow), shrub (narrow), sporophyte (narrow), suffrutex (narrow), suffrutices (narrow), tree (narrow), vine (narrow), woody clump (narrow), genet (broad), ramet (broad)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- Chloroplast and mitochondrial proteases in Arabidopsis. A proposed nomenclature. DOI: 10.1104/pp.125.4.1912 ; PMID: 11299370
- The VAR1 locus of Arabidopsis encodes a chloroplastic FtsH and is responsible for leaf variegation in the mutant alleles. DOI: 10.1046/j.1365-2443.2002.00558.x ; PMID: 12167156
- New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. DOI: 10.1074/jbc.M406763200 ; PMID: 15322131
- Functional redundancy of AtFtsH metalloproteases in thylakoid membrane complexes. DOI: 10.1104/pp.105.061234 ; PMID: 16040665
- Two types of FtsH protease subunits are required for chloroplast biogenesis and Photosystem II repair in Arabidopsis. DOI: 10.1105/tpc.105.035071 ; PMID: 16126834
- AtFtsH6 is involved in the degradation of the light-harvesting complex II during high-light acclimation and senescence. DOI: 10.1073/pnas.0503472102 ; PMID: 16157880
- Recent advances in the study of Clp, FtsH and other proteases located in chloroplasts. DOI: 10.1016/j.pbi.2006.03.010 ; PMID: 16603408
- The balance between protein synthesis and degradation in chloroplasts determines leaf variegation in Arabidopsis yellow variegated mutants. DOI: 10.1105/tpc.106.049270 ; PMID: 17416734
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Activation of the heterotrimeric G protein alpha-subunit GPA1 suppresses the ftsh-mediated inhibition of chloroplast development in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.03843.x ; PMID: 19228339
- The variegated mutants lacking chloroplastic FtsHs are defective in D1 degradation and accumulate reactive oxygen species. DOI: 10.1104/pp.109.146589 ; PMID: 19767385
- Photosynthetic redox imbalance governs leaf sectoring in the Arabidopsis thaliana variegation mutants immutans, spotty, var1, and var2. DOI: 10.1105/tpc.108.062752 ; PMID: 19897671
- Reactive oxygen species derived from impaired quality control of photosystem II are irrelevant to plasma-membrane NADPH oxidases. DOI: 10.4161/psb.5.3.10604 ; PMID: 20023407
- The FtsH protease heterocomplex in Arabidopsis: dispensability of type-B protease activity for proper chloroplast development. DOI: 10.1105/tpc.110.079202 ; PMID: 21062893
- Identification of nuclear genes encoding chloroplast-localized proteins required for embryo development in Arabidopsis. DOI: 10.1104/pp.110.168120 ; PMID: 21139083
- FtsH2 and FtsH5: two homologous subunits use different integration mechanisms leading to the same thylakoid multimeric complex. DOI: 10.1111/j.1365-313X.2010.04448.x ; PMID: 21214651
- Fitness analyses of Arabidopsis thaliana mutants depleted of FtsH metalloproteases and characterization of three FtsH6 deletion mutants exposed to high light stress, senescence and chilling. DOI: 10.1111/j.1469-8137.2011.03684.x ; PMID: 21438879
- A chloroplast-targeted DnaJ protein AtJ8 is negatively regulated by light and has rapid turnover in darkness. DOI: 10.1016/j.jplph.2011.04.001 ; PMID: 21592617
- FtsH proteases located in the plant chloroplast. DOI: 10.1111/j.1399-3054.2011.01548.x ; PMID: 22121866
- Cross-talk between calcium signalling and protein phosphorylation at the thylakoid. DOI: 10.1093/jxb/err403 ; PMID: 22197893
- Modified Clp protease complex in the ClpP3 null mutant and consequences for chloroplast development and function in Arabidopsis. DOI: 10.1104/pp.113.215699 ; PMID: 23548781
- A proteomics approach identifies novel proteins involved in gravitropic signal transduction. DOI: 10.3732/ajb.1200339 ; PMID: 23281391
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Identification and Roles of Photosystem II Assembly, Stability, and Repair Factors in Arabidopsis. DOI: 10.3389/fpls.2016.00168 ; PMID: 26909098
- Thylakoid-Bound FtsH Proteins Facilitate Proper Biosynthesis of Photosystem I. DOI: 10.1104/pp.16.00200 ; PMID: 27208291
- Phenotypic reversion in fas mutants of Arabidopsis thaliana by reintroduction of FAS genes: variable recovery of telomeres with major spatial rearrangements and transcriptional reprogramming of 45S rDNA genes. DOI: 10.1111/tpj.13257 ; PMID: 27377564
- Nitrogen remobilization during leaf senescence: lessons from Arabidopsis to crops. DOI: 10.1093/jxb/erw365 ; PMID: 27707774
- Structure of Psb29/Thf1 and its association with the FtsH protease complex involved in photosystem II repair in cyanobacteria. DOI: 10.1098/rstb.2016.0394 ; PMID: 28808107
- The Zinc-Finger Thylakoid-Membrane Protein FIP Is Involved With Abiotic Stress Response in Arabidopsis thaliana. DOI: 10.3389/fpls.2018.00504 ; PMID: 29720990
- FtsH Protease in the Thylakoid Membrane: Physiological Functions and the Regulation of Protease Activity. DOI: 10.3389/fpls.2018.00855 ; PMID: 29973948
- The Photosystem II Repair Cycle Requires FtsH Turnover through the EngA GTPase. DOI: 10.1104/pp.18.00652 ; PMID: 30131421
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- The PUB4 E3 Ubiquitin Ligase Is Responsible for the Variegated Phenotype Observed upon Alteration of Chloroplast Protein Homeostasis in Arabidopsis Cotyledons. DOI: 10.3390/genes12091387 ; PMID: 34573369
- Chloroplast and mitochondrial proteases in Arabidopsis. A proposed nomenclature. DOI: 10.1104/pp.125.4.1912 ; PMID: 11299370
- Proteomic study of the Arabidopsis thaliana chloroplastic envelope membrane utilizing alternatives to traditional two-dimensional electrophoresis. DOI: 10.1021/pr034025j ; PMID: 12938931
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. DOI: 10.1074/jbc.M406763200 ; PMID: 15322131
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
Sequence:
cDNA Sequence
- >AT5G42270.1 TGATAACACACGTAGACGAACCTGAAGCAATCACTCAAACTCAAGACTTCTCTTTAATCCTCCTCCCAAAAATCTCAGAGAATCCTCCTTCAATTCCAATTCAAAGCTCCTTCCTTTTTTCACATCTCTCTTCTTCAAATTCAATCATCATAAAAATCGAATCTTTATTCTTCAGAGAGCTTCAATGGCGACCACATCATCAAACCCATTACTACTTTCTTCAAATTTCCTCGGTTCTCAAATTATAATCTCAGCTCCAACACCAAAAACCACCACAAAGTCTCTTCCTTTCTCAGTAATCTCTCGAAAAAGATACCAAATTTCTCAATCGGAGAAGCTAATGAAATCGTTACCATCACAAGCTGCGTTAGCAGCTCTGTTGTTCTCATCTTCATCTCCACAAGCTTTAGCAGTTAACGAACCAGTTCAACCACCAGCACCAACCATTACTGCTGAAGCTCAATCACCAAATCTGTCGACTTTTGGTCAAAACGTTTTGATGACAGCACCGAATCCACAAGCTCAATCATCAGATCTTCCTGATGGAACACAATGGCGATACAGTGAGTTTCTAAATGCTGTGAAGAAAGGTAAAGTTGAGAGAGTGAAGTTTAGTAAAGATGGTTCTGTTCTTCAGTTAACAGCTGTTGATAATCGTCGTGCTACTGTTATTGTTCCTAATGATCCTGATTTGATTGATATCTTGGCGATGAATGGTGTTGATATATCTGTTTCTGAAGGAGAAGGTGGAAATGGGTTGTTTGATTTCATTGGTAATTTGCTTTTTCCTTTGTTGGCTTTTGGAGGGTTGTTTTATCTCTTTAGAGGAGGTCAAGGAGGTGCTGGTGGTCCTGGAGGTTTAGGAGGTCCTATGGATTTCGGAAGATCGAAATCGAAGTTTCAGGAAGTGCCTGAAACCGGTGTGACATTTGGTGATGTTGCTGGAGCTGATCAAGCTAAGCTTGAGTTACAAGAAGTTGTTGATTTCTTGAAGAATCCTGATAAGTATACTGCGTTAGGTGCTAAGATTCCTAAAGGTTGTTTGTTGGTTGGTCCACCGGGTACGGGGAAGACGCTTTTGGCTAGAGCTGTGGCTGGAGAAGCTGGAGTGCCGTTCTTTTCGTGTGCTGCTTCGGAGTTTGTTGAGCTTTTTGTTGGTGTGGGTGCTTCTAGAGTTAGGGATTTATTTGAGAAGGCGAAATCGAAAGCTCCTTGTATTGTGTTTATTGATGAGATTGATGCTGTTGGTAGACAAAGAGGAGCTGGGATGGGTGGTGGAAATGATGAGAGGGAACAGACTATTAATCAGCTTTTGACTGAGATGGATGGGTTTTCTGGTAACTCTGGTGTCATTGTGTTGGCTGCCACTAATAGACCGGATGTTCTTGACTCCGCGTTGCTGAGACCTGGTAGATTTGACCGGCAAGTCACAGTGGATAGGCCTGATGTAGCCGGAAGAGTTCAGATCCTTAAGGTGCATTCTAGAGGAAAAGCTATTGGGAAGGATGTTGATTACGAAAAAGTTGCGAGGAGAACTCCGGGTTTCACTGGTGCTGATTTGCAGAACCTGATGAATGAAGCTGCGATTCTTGCTGCTAGACGTGAGCTTAAGGAGATAAGCAAGGATGAAATATCTGATGCTCTTGAGAGGATCATTGCTGGACCTGAAAAGAAGAACGCTGTTGTCTCTGAGGAGAAGAAAAGACTTGTTGCTTACCATGAGGCTGGGCATGCTTTAGTTGGTGCACTTATGCCGGAGTATGATCCAGTGGCCAAGATATCGATTATTCCACGTGGCCAAGCTGGTGGGCTCACCTTTTTCGCTCCTAGCGAAGAGAGGCTAGAGTCCGGATTGTATAGCAGAAGCTACCTTGAGAACCAAATGGCTGTTGCACTTGGTGGAAGGGTTGCAGAAGAGGTGATCTTTGGAGACGAGAATGTGACAACCGGAGCATCAAATGATTTCATGCAAGTGTCGCGGGTGGCTCGCCAAATGGTTGAGAGATTCGGGTTCAGCAAAAAGATTGGACAAGTTGCAGTTGGTGGAGCAGGAGGAAACCCTTTCTTGGGTCAAAGTATGTCATCGCAGAAGGATTACTCGATGGCAACAGCGGATGTGGTTGATGCGGAAGTGAGAGAGCTCGTTGAGAAGGCGTACGTGAGAGCGAAAGAGATCATAACAACACAAATTGATATCCTACACAAGCTTGCACAGCTCCTTATTGAGAAAGAAACTGTGGATGGAGAAGAGTTCATGAGTCTTTTCATTGACGGACAAGCCGAGTTATATGTTTCTTAAAATCAACTAATTGGCTTGTAATAATACCAATTAGCTTCGATCTATACATACTGTATGTTAATATACATTGACATGTTCAGAGACTTTTCTTTTTCTTTTTCTTTGCTGCCGCTTTCGATTCCCAAAATAGTGAAAATACTCTCATCGTTCCGACACAAGTCTATATATGCAAACAAATGCATTCTTATTATT
CDS Sequence
Protein Sequence