Gene Details:
- Gene ID: AT5G42790
- Gene Symbol: ARS5, ATPSM30, PAF1
- Gene Name: ARSENIC TOLERANCE 5, proteasome alpha subunit F1
- Description: proteasome alpha subunit F1;(source:Araport11)
- TAIR Accession: locus:2165512
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0006511 — involved in — ubiquitin-dependent protein catabolic process
- GO:0009536 — located in — plastid
- GO:0006511 — acts upstream of or within — ubiquitin-dependent protein catabolic process
- GO:0010498 — involved in — proteasomal protein catabolic process
- GO:0030163 — acts upstream of or within — protein catabolic process
- GO:0005829 — located in — cytosol
- GO:0019773 — part of — proteasome core complex, alpha-subunit complex
- GO:0005737 — located in — cytoplasm
- GO:0000502 — part of — proteasome complex
- GO:0005839 — part of — proteasome core complex
- GO:0046685 — acts upstream of or within — response to arsenic-containing substance
Function-related keywords:
Literature:
- Structure and functional analysis of the 26S proteasome subunits from plants. DOI: 10.1023/a:1006926322501 ; PMID: 10363660
- Molecular organization of the 20S proteasome gene family from Arabidopsis thaliana. DOI: 10.1093/genetics/149.2.677 ; PMID: 9611183
- The 20S proteasome gene family in Arabidopsis thaliana. DOI: 10.1016/s0014-5793(97)01228-3 ; PMID: 9373170
- OrthoParaMap: distinguishing orthologs from paralogs by integrating comparative genome data and gene phylogenies. DOI: 10.1186/1471-2105-4-35 ; PMID: 12952558
- Stress-induced protein S-glutathionylation in Arabidopsis. DOI: 10.1104/pp.104.058917 ; PMID: 16055689
- Proteomic analysis of different mutant genotypes of Arabidopsis led to the identification of 11 proteins correlating with adventitious root development. DOI: 10.1104/pp.105.067868 ; PMID: 16377752
- Identification of an arsenic tolerant double mutant with a thiol-mediated component and increased arsenic tolerance in phyA mutants. DOI: 10.1111/j.1365-313X.2006.03018.x ; PMID: 17335514
- but not monomethylation on histone H3 lysine 36 marks active transcription of genes involved in flowering time regulation and other processes in Arabidopsis thaliana. DOI: 10.1128/MCB.01607-07 ; PMID: 18070919
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- ARS5 is a component of the 26S proteasome complex, and negatively regulates thiol biosynthesis and arsenic tolerance in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.03914.x ; PMID: 19453443
- Affinity purification of the Arabidopsis 26 S proteasome reveals a diverse array of plant proteolytic complexes. DOI: 10.1074/jbc.M110.136622 ; PMID: 20516081
- Arabidopsis thaliana VOZ (Vascular plant One-Zinc finger) transcription factors are required for proper regulation of flowering time. DOI: 10.1242/bio.20133764 ; PMID: 23616927
- Structure, function and regulation of plant proteasomes. DOI: 10.1016/j.biochi.2007.07.019 ; PMID: 17825468
- The Ubiquitin E3 Ligase PRU2 Modulates Phosphate Uptake in Arabidopsis. DOI: 10.3390/ijms23042273 ; PMID: 35216388
- Coordinated histone variant H2A.Z eviction and H3.3 deposition control plant thermomorphogenesis. DOI: 10.1111/nph.18738 ; PMID: 36647799
- Structure and functional analysis of the 26S proteasome subunits from plants. DOI: 10.1023/a:1006926322501 ; PMID: 10363660
- The 20S proteasome gene family in Arabidopsis thaliana. DOI: 10.1016/s0014-5793(97)01228-3 ; PMID: 9373170
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequence:
cDNA Sequence
- >AT5G42790.1 GCCCAATAAGCTAGATACCGAGCCAATACAAAGCCCAGAATTTAATAGAAGCCCATTAAATCGAGAGAGAGATCGAGAGCATCCATGGCTTGAAGGAAAAGAAAAGTTTTGTTTCTGAACTTTCGTCTCTATAAACCCTTTCGACGACGAGTGAAGAAGAAAGCGAGACGAAGAAGCAAAGATGTTCAGAAACCAATACGACACAGATGTTACGACATGGAGTCCAACAGGTCGTTTATTCCAAGTGGAATACGCCATGGAAGCAGTGAAGCAAGGATCTGCAGCAATTGGACTCAGATCTCGTTCTCATGTCGTTCTCGCTTGTGTTAACAAAGCTCAATCGGAGCTTTCTTCGCATCAGAGGAAGATCTTTAAAGTCGATGACCATATCGGTGTTGCAATCGCTGGTCTCACAGCCGACGGTCGTGTATTGTCTCGGTATATGAGATCGGAATCGATTAATCACTCTTTTACTTATGAGTCTCCTCTTCCTGTTGGTCGTCTCGTTGTTCATCTTGCTGATAAAGCTCAGGTCTGTACCCAACGATCATGGAAACGACCCTATGGTGTTGGTTTGCTGGTAGGTGGATTGGATGAGTCTGGAGCCCACCTTTACTACAACTGTCCCAGCGGAAACTACTTCGAGTACCAAGCTTTTGCTATTGGATCCCGTTCCCAAGCAGCAAAGACCTATCTGGAACGCAGGTTTGAGAGCTTTGGGGATTCTTCTAGAGAAGATCTGATCAAAGATGCTATTTTGGCTGTTAGGGAGACATTGCAAGGGGAAACACTGAAGAGTTCTCTCTGCACAGTCGCTATTCTAGGAGTCGATGAACCGTTCCACTTCCTGGACCAGGAAGCAATACAGAAAGTGATCGACACATTTGAGAAAGTGCCAGAGGAAGAGGAAGGAGAAGGCGAGGCTGGTGAGGGTGAGGCCGAAGCTGCCGAGGCTGCACCAGCAGAACGAGGTGGTGGTGTTGCAGGTGACCAAGACGTGGCTCCAATGGAAATGTAAGGCTTGTGTGTGTAACGCTGGAACTATTTTATTTCGATGTTAGTTGGATTTTTACTTTGCAAAATGGCTGCGGGTTTAGATTATATGCTTGAGAAGTTGAAACCATTTCGTCATTTAAACTCAATAGCTGCCATCAAGACTTTCTCGTATTCTGGTCTTTTGGTTTAAATCTGAAATCTGTTCACGACTTCCTATCTCTTTGGTTCTGCAATTCCTTGCTAAAAAA
CDS Sequence
Protein Sequence