Gene Details:
- Gene ID: AT5G43066
- Gene Symbol: prePIPL4
- Gene Name: Precursor of PAMP-induced peptide-like 4
- Description: transmembrane protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Literature:
- A large number of novel coding small open reading frames in the intergenic regions of the Arabidopsis thaliana genome are transcribed and/or under purifying selection. DOI: 10.1101/gr.5836207 ; PMID: 17395691
- The secreted peptide PIP1 amplifies immunity through receptor-like kinase 7. DOI: 10.1371/journal.ppat.1004331 ; PMID: 25188390
- The IDA/IDA-LIKE and PIP/PIP-LIKE gene families in Arabidopsis: phylogenetic relationship, expression patterns, and transcriptional effect of the PIPL3 peptide. DOI: 10.1093/jxb/erv285 ; PMID: 26062745
- A large number of novel coding small open reading frames in the intergenic regions of the Arabidopsis thaliana genome are transcribed and/or under purifying selection. DOI: 10.1101/gr.5836207 ; PMID: 17395691
Sequence:
cDNA Sequence
- >AT5G43066.1 ATGGAGAAAAAGAATATGTTCGTGCTGTGTATGATCTTGTTATTGGTGGGCTCGTCGTTGATGTTTGAGAGAGTTGATTGCAGAGTCGTACGATCGGAGCCTTTCAGAGATATCAACGGCCATGATCAATCAACGGCGACCAAGGTGAAGAGAAGCTCGTGCAGTCGACGTCCTTTGATGAGGATTCTAGCGTCTGGACCGAACAAAAGAGGACGTGGTCACTGA
CDS Sequence
Protein Sequence