Gene Details:
- Gene ID: AT5G43510
- Gene Symbol: AtLURE1.2, CRP810_1.2, LURE1.2
- Gene Name: LURE 1.2
- Description: Putative membrane lipoprotein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000191 — synergid — sinérgida (Spanish, exact), 助細胞 (Japanese, exact)
- PO:0009030 — carpel — carpelo (Spanish, exact), 心皮 (Japanese, exact), Poaceae carpel (narrow), Zea carpel (narrow), pistil (broad)
Function-related keywords:
Literature:
- Analysis of the female gametophyte transcriptome of Arabidopsis by comparative expression profiling. DOI: 10.1104/pp.105.067314 ; PMID: 16299181
- Identification of genes expressed in the Arabidopsis female gametophyte. DOI: 10.1111/j.1365-313X.2007.03137.x ; PMID: 17559508
- Genetic subtraction profiling identifies genes essential for Arabidopsis reproduction and reveals interaction between the female gametophyte and the maternal sporophyte. DOI: 10.1186/gb-2007-8-10-r204 ; PMID: 17915010
- SHINE transcription factors act redundantly to pattern the archetypal surface of Arabidopsis flower organs. DOI: 10.1371/journal.pgen.1001388 ; PMID: 21637781
- Tip-localized receptors control pollen tube growth and LURE sensing in Arabidopsis. DOI: 10.1038/nature17413 ; PMID: 26961657
- Fertilized egg cells secrete endopeptidases to avoid polytubey. DOI: 10.1038/s41586-021-03387-5 ; PMID: 33790463
- Small cysteine-rich peptides resembling antimicrobial peptides have been under-predicted in plants. DOI: 10.1111/j.1365-313X.2007.03136.x ; PMID: 17565583
Sequence:
cDNA Sequence
- >AT5G43510.2 AAACGATTCACAATAATATTTAATATATTTTCTTTGTGATATTGGTTAATTTCTACCAAGAAATGAAGTTGCCTATTATATTCTTAACTCTATTAATTTTTGTTTCTTCATGTACATCAACACTTATAAATGGATCTAGTGATGAAGAGAGAACATATTCTTTCAGTCCAACAACAAGTCCTTTTGATCCACGCTCACTGAACCAAGAACTTAAAATTGGGAGAATTGGTTACTGTTTTGATTGCGCAAGAGCTTGTATGAGACGGGGTAAGTATATTCGTACATGTAGTTTTGAAAGAAAACTTTGTCGTTGCAGTATTAGTGATATTAAATAAGGCATTG
CDS Sequence
Protein Sequence