Gene Details:
- Gene ID: AT5G43860
- Gene Symbol: ATCLH2, CLH2
- Gene Name: ARABIDOPSIS THALIANA CHLOROPHYLLASE 2, chlorophyllase 2
- Description: chlorophyllase 2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000014 — rosette leaf — hoja en roseta (Spanish, exact), ロゼット葉 (Japanese, exact)
Function-related keywords:
Literature:
- Cloning of chlorophyllase, the key enzyme in chlorophyll degradation: finding of a lipase motif and the induction by methyl jasmonate. DOI: 10.1073/pnas.96.26.15362 ; PMID: 10611389
- Altering the expression of the chlorophyllase gene ATHCOR1 in transgenic Arabidopsis caused changes in the chlorophyll-to-chlorophyllide ratio. DOI: 10.1104/pp.010813 ; PMID: 11950974
- Genome organization in Arabidopsis thaliana: a survey for genes involved in isoprenoid and chlorophyll metabolism. DOI: 10.1023/a:1023005504702 ; PMID: 12777052
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Chlorophyllase 1, a damage control enzyme, affects the balance between defense pathways in plants. DOI: 10.1105/tpc.104.025817 ; PMID: 15598807
- The genetic basis of zinc tolerance in the metallophyte Arabidopsis halleri ssp. halleri (Brassicaceae): an analysis of quantitative trait loci. DOI: 10.1534/genetics.106.064485 ; PMID: 17409091
- The senescence-induced staygreen protein regulates chlorophyll degradation. DOI: 10.1105/tpc.106.044891 ; PMID: 17513504
- The chlorophyllases AtCLH1 and AtCLH2 are not essential for senescence-related chlorophyll breakdown in Arabidopsis thaliana. DOI: 10.1016/j.febslet.2007.10.060 ; PMID: 17996203
- Repression of AtCLH1 expression results in a decrease in the ratio of chlorophyll a/b but doesnot affect the rate of chlorophyll degradation during leaf senescence. DOI: NA ; PMID: 18349515
- and pathogen-induced jasmonate biosynthesis: redundant lipases contribute to jasmonate formation. DOI: 10.1104/pp.110.155093 ; PMID: 20348210
- Expression of enzymes involved in chlorophyll catabolism in Arabidopsis is light controlled. DOI: 10.1104/pp.111.185504 ; PMID: 21896889
- Chlorophyll degradation: the tocopherol biosynthesis-related phytol hydrolase in Arabidopsis seeds is still missing. DOI: 10.1104/pp.114.243709 ; PMID: 25059706
- Analysis of an Arabidopsis heat-sensitive mutant reveals that chlorophyll synthase is involved in reutilization of chlorophyllide during chlorophyll turnover. DOI: 10.1111/tpj.12611 ; PMID: 25041167
- Genome Wide Association Mapping for the Tolerance to the Polyamine Oxidase Inhibitor Guazatine in Arabidopsis thaliana. DOI: 10.3389/fpls.2016.00401 ; PMID: 27092150
- Subcellular localization of chlorophyllase2 reveals it is not involved in chlorophyll degradation during senescence in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2019.110314 ; PMID: 31779896
- Shade represses photosynthetic genes by disrupting the DNA binding of GOLDEN2-LIKE1. DOI: 10.1093/plphys/kiad029 ; PMID: 36702576
Sequence:
cDNA Sequence
- >AT5G43860.1 CTCATTCTCATGAACCCACCAAACAAAAAAAGTAAAGAAAAGAAAAACTAATAAAGAACAAAAAAAATGTCCTCTTCTTCATCAAGAAACGCCTTTGAAGATGGCAAATACAAATCAAATCTCTTAACCTTGGACTCATCATCTCGTTGCTGCAAAATAACACCGTCTTCTAGAGCTTCACCGTCTCCGCCAAAGCAGCTGTTGGTGGCTACGCCGGTGGAGGAAGGAGATTATCCGGTGGTGATGCTCCTCCATGGTTACCTTCTCTACAACTCCTTCTATTCTCAGCTTATGTTGCATGTCTCTTCTCATGGCTTCATCCTCATCGCTCCTCAGTTATATAGTATCGCCGGACCAGACACAATGGATGAGATTAAATCAACGGCGGAGATTATGGATTGGTTATCAGTAGGACTTAATCACTTTCTTCCAGCGCAAGTAACACCAAACCTATCCAAATTTGCCCTCTCCGGCCATAGCCGCGGTGGCAAAACCGCGTTTGCGGTCGCCTTAAAGAAATTTGGGTACTCCTCGAATCTAAAGATCTCGACATTGATCGGTATAGATCCAGTCGATGGAACAGGGAAAGGGAAACAAACCCCTCCTCCGGTGTTGGCTTACCTTCCAAACTCATTTGACCTAGACAAAACGCCTATACTTGTGATCGGTTCGGGGCTTGGTGAAACCGCTCGGAACCCATTATTCCCACCGTGTGCACCTCCCGGAGTGAATCACCGAGAGTTCTTTCGGGAATGTCAAGGTCCAGCATGGCATTTCGTTGCGAAGGATTATGGGCATTTGGACATGCTTGATGATGATACAAAAGGGATTAGAGGGAAGAGTTCTTATTGTTTGTGTAAGAATGGTGAAGAGAGGAGACCAATGAGGAGATTCGTTGGTGGACTTGTTGTATCATTTTTGAAGGCTTATTTGGAAGGAGATGATCGTGAATTAGTTAAGATCAAAGATGGGTGTCACGAGGATGTTCCCGTTGAAATTCAAGAGTTTGAGGTTATCATGTAAACATAAGTTTTTCTTTAGGGGCTGGTTTTTCTATTGTCAATATCATCAGCTTTTGTTGCTTATGGTTTTACAAACTTATATTGTACAACTCTTTAAGTCACCTCTTTGCTTATGATATTAACCCGATCACATTCACAATACTAGAAGAGTGAAC
CDS Sequence
Protein Sequence