Gene Details:
- Gene ID: AT5G44140
- Gene Symbol: ATPHB7, PHB7
- Gene Name: prohibitin 7, prohibitin 7
- Description: prohibitin 7;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Literature:
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Isolation of intact vacuoles and proteomic analysis of tonoplast from suspension-cultured cells of Arabidopsis thaliana. DOI: 10.1093/pcp/pch099 ; PMID: 15215502
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Mitochondrial type-I prohibitins of Arabidopsis thaliana are required for supporting proficient meristem development. DOI: 10.1111/j.1365-313X.2007.03276.x ; PMID: 17883375
- Resolving and identifying protein components of plant mitochondrial respiratory complexes using three dimensions of gel electrophoresis. DOI: 10.1021/pr700595p ; PMID: 18189341
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Mitochondrial type-I prohibitins of Arabidopsis thaliana are required for supporting proficient meristem development. DOI: 10.1111/j.1365-313X.2007.03276.x ; PMID: 17883375
- Resolving and identifying protein components of plant mitochondrial respiratory complexes using three dimensions of gel electrophoresis. DOI: 10.1021/pr700595p ; PMID: 18189341
Sequence:
cDNA Sequence
- >AT5G44140.1 ATGAATGTGAAAAAAGTTCCAAACGTTCCTGGATCACCTGCACTCTCTGCCTTGCTTAAGCTCGGTGTTATTGGTGGACTTGGACTCTATTGCATTGGTAGTAGCATGTACAATGTCGATGGAGGACACCGTGCCATCGTGTTTAACCGGTTTACCGGTATCAAAGATAGGGTTTATCCAGAGGGTACTCATTTTAAGATACCATTGTTTGAAAGAGCAATTATCTATGATGTTCGTTCTCGACCTTACGTTGAGAATAGCCAAACTGGAAGTAATGATCTTCAAACGGTGACTATTGGGCTTAGGGTACTTACACGTCCTATGGGAGACCGCTTACCCGAGATTTACAGAACACTCGGTCAGAATTATGGAGAGCGAGTTCTTCCTTCCATTATCAATGAAACACTGAAAGCAGTAGTGGCTCAGTACAATGCAAGCCACCTCATTACACAGAGAGAAGCTGTGAGTAGGGAGATACGCAAGATTGTGACAGAGCGAGCAGCTAAATTTAACATTGCTTTAGATGATGTATCTATCACAAACCTCAAATTTGGCAAAGAGTTTACTGAAGCAATCGAGAAGAAACAAGTTGCGGCTCAGGAAGCAGAACGGGCTAAGTTCATTGTCGAAAAGGCCGAGCAAGACAAGAAAAGTGCTATTATCCGCGCTCAGGGAGAAGCTAAGAGTGCTCAACTCATAGGGCAAGCTATTGCGAACAATGAAGCTTTCATTACTCTGAGGAAGATTGAAGCTGCAAGAGAGATTGCTCAGACCATAGCTAAATCGGCGAACAAGGTTTACCTAAACTCCAGTGATCTCTTAATCTCCAAGCAATGAACTTGGAGCCCAGCCCTAACAACTAGAGAAACAAAAG
CDS Sequence
Protein Sequence