Gene Details:
- Gene ID: AT5G67590
- Gene Symbol: FRO1, NDUFS4
- Gene Name: FROSTBITE1, NADH:ubiquinone oxidoreductase Fe-S protein4
- Description: NADH-ubiquinone oxidoreductase-like protein;(source:Araport11)
- TAIR Accession: locus:2158621
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0009631 — acts upstream of or within — cold acclimation
- GO:0008137 — enables — NADH dehydrogenase (ubiquinone) activity
- GO:0005739 — located in — mitochondrion
- GO:0006970 — acts upstream of or within — response to osmotic stress
- GO:0005747 — part of — mitochondrial respiratory chain complex I
- GO:0022900 — involved in — electron transport chain
- GO:0009536 — located in — plastid
- GO:0050897 — enables — cobalt ion binding
Germplasm Phenotype:
- fro1 — Reduced capacity for cold acclimation, altered leaf morphology
Function-related keywords:
- shoot axis apex , plant embryo , stamen , sepal , flower , collective leaf structure , pollen , guard cell
Literature:
- A mitochondrial complex I defect impairs cold-regulated nuclear gene expression. DOI: 10.1105/tpc.010433 ; PMID: 12084824
- Mitochondrial complex I from Arabidopsis and rice: orthologs of mammalian and fungal components coupled with plant-specific subunits. DOI: 10.1016/s0005-2728(03)00045-8 ; PMID: 12837548
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Natural genetic variation in whole-genome expression in Arabidopsis thaliana: the impact of physiological QTL introgression. DOI: 10.1111/j.1365-294X.2006.02774.x ; PMID: 16626458
- Resolving and identifying protein components of plant mitochondrial respiratory complexes using three dimensions of gel electrophoresis. DOI: 10.1021/pr700595p ; PMID: 18189341
- Comparative mapping of Brassica juncea and Arabidopsis thaliana using Intron Polymorphism (IP) markers: homoeologous relationships, diversification and evolution of the A, B and C Brassica genomes. DOI: 10.1186/1471-2164-9-113 ; PMID: 18315867
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Divalent metal ions in plant mitochondria and their role in interactions with proteins and oxidative stress-induced damage to respiratory function. DOI: 10.1104/pp.109.147942 ; PMID: 20018591
- Proteomic approach to characterize mitochondrial complex I from plants. DOI: 10.1016/j.phytochem.2010.11.012 ; PMID: 21167537
- Complete Mitochondrial Complex I Deficiency Induces an Up-Regulation of Respiratory Fluxes That Is Abolished by Traces of Functional Complex I. DOI: 10.1104/pp.15.00589 ; PMID: 26134164
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Mitochondrial function modulates touch signalling in Arabidopsis thaliana. DOI: 10.1111/tpj.14183 ; PMID: 30537160
- Different Types Domains are Present in Complex I from Immature Seeds and of CA Adult Plants in Arabidopsis thaliana. DOI: 10.1093/pcp/pcz011 ; PMID: 30668784
- Alteration of iron responsive gene expression in Arabidopsis glutaredoxin S17 loss of function plants with or without iron stress. DOI: 10.1080/15592324.2020.1758455 ; PMID: 32351167
- Mitochondrial complex I from Arabidopsis and rice: orthologs of mammalian and fungal components coupled with plant-specific subunits. DOI: 10.1016/s0005-2728(03)00045-8 ; PMID: 12837548
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Resolving and identifying protein components of plant mitochondrial respiratory complexes using three dimensions of gel electrophoresis. DOI: 10.1021/pr700595p ; PMID: 18189341
Sequence:
cDNA Sequence
- >AT5G67590.1 ATTTTTCATATAATAGTAAGACCGAAAGCGTAATTTATAAAATTTTGATGGCTAGATTGAAATATGTGTTTTTTTTTTCTTTCTAAAATCTACAGAAGTAGAAGAAACCAAAGCGAAATCAAAAAGCTCAGCAATTTTCCAGATTTCTCTAATTGACGATGGCGCTTTGTGCTACTACTCAAAGGACTATCCGTATAGCGGCGACGCTCCGGCGTGTTGCTCGACCTTTCGCTACTGACGCGGTGGTTGAGTCGGATTACAAGCGTGGTGAGATCGGTAAGGTCTCCGGAATCCCAGAGGAGCATCTTTCTCGCAAGGTGATAATATACTCACCTGCTAGAACAGCTACCCAGTCAGGATCTGGAAAACTCGGAAAATGGAAGATTAACTTCGTCTCCACCTTAAAGTGGGAGAATCCGTTGATGGGATGGACTTCTACAGGTGACCCCTATGCTAATGTTGGTGACTCTGCTCTTGCTTTTGATTCTGAAGAAGCTGCTAAGTCTTTTGCTGAGCGTCATGGTTGGGATTATAAGGTCAAGAAGCCCAACACACCATTATTGAAGGTCAAGTCTTACTCGGACAACTTCAAGTGGAAAGGCAATCCTCAACCAGAAAACTGATGTTACACCTTCTTCCAATTCTTCTCGAGCAAAAGAAGAAACCTCATTTGATATTAATTCTCATGTTTCTTTGTTATTTTAGCATCTGTGAGCTTTTTGGTTGAAAAGAACCATTATCCATGGCTATGTTTACTTATTACAATAATATGATGATGATGATGAAACACACTCCTTTGATATTTCATCAAGATTTCTGATCAC
CDS Sequence
Protein Sequence