Gene Details:
- Gene ID: Gh_D08G2323
- Gene Symbol: GhUBC2L
- Gene Name:
- Genome: TM1_NBI
- Species: Gossypium hirsutum
Functional Descriptions:
- Identify an E2 gene GhUBC2L and show its positive role in cell proliferation and expansion.
- Complete knock-down of GhUBC2L in cotton resulted in retarded growth and reduced organ size.
- Overexpression of GhUBC2L promoted cotton growth, generating enlarged organs in size. Monoubiquitination of H2A and H2B was strongly impaired in GhUBC2L-suppressed cotton but slightly enhanced in GhUBC2L-overexpressed plant.
- GhUBC2L modulates histone monoubiquitination synergistically with GhUbox8 to regulate the expression of genes involved in organ development and cell cycle, thus controlling organ size in cotton.
- We identified an E2 enzyme GhUBC2L that modulates histone monoubiquitination synergistically with an E3 ligase GhUbox8 to mediate organ size control in cotton.
Function-related keywords:
- growth , development , plant-development , plant-growth , cell-cycle , cell-proliferation , organ-size , cell-expansion
Literature:
- Histone ubiquitination controls organ size in cotton (Gossypium hirsutum). DOI: 10.1111/tpj.15716 ; PMID: 35218092
Related News:
Gene Resources:
Sequences:
cDNA Sequence
CDS Sequence
- />Gh_D08G2323
ATGTCAACCCCAGCAAGGAAGAGGCTGATGAGAGACTTCAAGAGACTACAGCAAGATCCACCTGCTGGTATTAGTGGGGCTCCTCAAGATAATAATATCATGTTTTGGAACGCTGTCATTTTTGGGCCTGATGATACTCCTTGGGATGGCGGTACGTTCAAGCTGACTTTGCAGTTCATGGAGGATTATCCAAATAAGCCTCCAACCGTTCGGTTTGTCTCACGGATGTTTCATCCAAATATCTATGCAGATGGGAGTATTTGTCTCGATATTTTACAAAATCAGTGGAGTCCTATATATGATGTTGCCGCTATACTCACTTCGATTCAGTCTCTTCTTTGTGATCCGAACCCGAACTCTCCAGCAAACTCGGAAGCAGCTCGTATGTTTAGTGAGAATAAGCGGGAATACAACCGAAGAGTGCGCGAAATAGTGGAGCAGAGCTGGACTGCTGACTGA
Protein Sequence
- />Gh_D08G2323
MSTPARKRLMRDFKRLQQDPPAGISGAPQDNNIMFWNAVIFGPDDTPWDGGTFKLTLQFMEDYPNKPPTVRFVSRMFHPNIYADGSICLDILQNQWSPIYDVAAILTSIQSLLCDPNPNSPANSEAARMFSENKREYNRRVREIVEQSWTAD