Gene Details:
- MSU gene ID: LOC_Os02g41904
- RAPdb gene ID: Os02g0629800
- Gene Symbol: OsDEF7 CAL1 OsAFP1
- Genome: MSU7 , IRGSP-1.0
- Species: Oryza sativa
Functional Descriptions:
- CAL1 is expressed preferentially in root exodermis and xylem parenchyma cells.
- We provide evidence that CAL1 acts by chelating Cd in the cytosol and facilitating Cd secretion to extracellular spaces, hence lowering cytosolic Cd concentration while driving long-distance Cd transport via xylem vessels.
- OsAFP1 exerted fungicidal activity against Candida albicans, the most common pathogenic fungus in humans, at 4<U+2009>
M concentration, but it did not inhibit the growth of human pathogenic bacteria. - Immunohistochemistry showed that the OsAFP1 target molecule was located in the cell wall.
- Further, PI uptake and apoptosis assays suggested that OsAFP1 exerts its antifungal activity by inducing apoptosis of target cells.
- Partial peptides from rice defensin OsAFP1 exhibited antifungal activity against the rice blast pathogen Pyricularia oryzae.
- In lipid-binding analyses performed using nitrocellulose membranes immobilized with various membrane lipid components, OsAFP1 was found to bind to phosphatidylinositols (PIPs) harboring phosphate groups, particularly PI(3)P.
Function-related keywords:
- xylem , root , xylem-parenchyma , growth , cell-wall , Pi , pi , Pi-uptake , blast , pathogen , phosphate
Literature:
- Gene expression analysis, subcellular localization, and in planta antimicrobial activity of rice (Oryza sativa L.) defensin 7 and 8 . DOI: 10.1016/j.plaphy.2018.01.011 ; PMID: 29414311
- A defensin-like protein drives cadmium efflux and allocation in rice . DOI: 10.1038/s41467-018-03088-0 ; PMID: 29440679
- Rice Defensin OsAFP1 is a New Drug Candidate against Human Pathogenic Fungi . DOI: 10.1038/s41598-018-29715-w ; PMID: 30061724
- Partial peptides from rice defensin OsAFP1 exhibited antifungal activity against the rice blast pathogen Pyricularia oryzae . DOI: 10.1584/jpestics.D17-046 ; PMID: 30363094
- Crystal structure of rice defensin OsAFP1 and molecular insight into lipid-binding . DOI: 10.1016/j.jbiosc.2020.02.011 ; PMID: 32192842
- Effects of Fe and Mn cations on Cd uptake by rice plant in hydroponic culture experiment . DOI: 10.1371/journal.pone.0243174 ; PMID: 33301482
Related News:
Gene Resources:
Sequences:
cDNA Sequence
- >LOC_Os02g41904.1 cDNA ATCAACCAAGAGCTAGCACAGCACCGGTGGCAGTAGCAAAGTAGCAGCCTCATCACTCATCAGTGAGCGCAGTTCGAGTCGCCGGTACAGATGGCTCCGTCTCGTCGCATGGTCGCGTCCGCCTTCCTCCTCCTGGCCATCCTCGTCGCCACAGAGATGGGGACGACCAAGGTGGCGGAGGCGAGGCACTGCCTGTCGCAGAGCCACAGGTTCAAGGGCATGTGCGTGAGCAGCAACAACTGCGCCAACGTGTGCAGGACGGAGAGCTTCCCCGACGGCGAGTGCAAGTCGCACGGCCTCGAGCGCAAGTGCTTCTGCAAGAAGGTCTGCTAGTGCATGCTAGCCCCGCTGTCTCTGCAGTCGCATTGCTCGTCGGCTGTGTATCTGCAGAGATTGTAGTCGCGTGTTCTCCTTTGTCTGTTGTTCATGACGAGCTTCTGTTCTTGGCTTACAGGCTAGTTGAGTTGCTTTCGATTATCCTTGCTTAGAATAAGTAATAAGTACGCGCTGGATACATGCTCCAGCTTAGTTAGTTGTTGGGTATTTGCAAGCTGCTGTCATGTAAGGTTCCACATTTCAGCATTAATGAATTGGCATACGTGATGAATCTGTGTGCTTACGATCGTTTCATCAGTTAA
CDS Sequence
- >LOC_Os02g41904.1 CDS ATGGCTCCGTCTCGTCGCATGGTCGCGTCCGCCTTCCTCCTCCTGGCCATCCTCGTCGCCACAGAGATGGGGACGACCAAGGTGGCGGAGGCGAGGCACTGCCTGTCGCAGAGCCACAGGTTCAAGGGCATGTGCGTGAGCAGCAACAACTGCGCCAACGTGTGCAGGACGGAGAGCTTCCCCGACGGCGAGTGCAAGTCGCACGGCCTCGAGCGCAAGTGCTTCTGCAAGAAGGTCTGCTAG
Protein Sequence
- >LOC_Os02g41904.1 protein MAPSRRMVASAFLLLAILVATEMGTTKVAEARHCLSQSHRFKGMCVSSNNCANVCRTESFPDGECKSHGLERKCFCKKVC*