Gene Details:
- MSU gene ID: LOC_Os06g44010
- RAPdb gene ID: Os06g0649000
- Gene Symbol: OsWRKY28
- Genome: MSU7 , IRGSP-1.0
- Species: Oryza sativa
Functional Descriptions:
- The transcription factor OsWRKY28 acts as a negative regulator of basal resistance, like the orthologous barley gene.
- In this study, we comprehensively analyzed the role of one of the group IIa WRKY transcription factors in rice, OsWRKY28, in the regulation of basal defense responses to a compatible race of the rice blast fungus Magnaporthe oryzae, strain Ina86-137.
- Finally, transcriptome analysis revealed that the induction of several defense-related genes in the wild type after Ina86-137 infection was counteracted in OsWRKY28-overexpressing rice plants.
- These results strongly suggest that OsWRKY28 is a negative regulator of basal defense responses against Ina86-137 and acts as a modulator to maintain the responses at an appropriate level by attenuating the activation of defense-related gene expression levels.
- The expression analyses of the group IIa WRKY transcription factors in rice revealed that OsWRKY28, together with OsWRKY71, exhibit an early-induced expression prior to the late-induced expressions of OsWRKY62 and OsWRKY76.
- Here, we report that a large inverted repeat construct designed to knock down the expression of the four OsWRKY IIa subfamily members (OsWRKY62, OsWRKY28, OsWRKY71, and OsWRKY76) leads to overexpression of all four genes and disease resistance in some transgenic plants.
- OsWRKY28, a PAMP-responsive transrepressor, negatively regulates innate immune responses in rice against rice blast fungus.
- OsWRKY28 Regulates Phosphate and Arsenate Accumulation, Root System Architecture and Fertility in Rice.
- Exogenous JA treatments mimicked the phenotypes of the OsWRKY28 mutants with inhibited root elongation and decreased arsenate/phosphate translocation.
- Our results suggested that OsWRKY28 affected arsenate/phosphate accumulation, root development at the seedling stage and fertility at the reproductive stage possibly by influencing homeostasis of JA or other phytohormones.
- The expression of OsWRKY28 was markedly induced by arsenate and other oxidative stresses.
- In a hydroponic experiment, loss-of-function mutation in OsWRKY28 resulted in lower accumulation of arsenate and phosphate concentration in the shoots.
- In this study, we explored the functions of a transcription factor OsWRKY28 in rice.
- The OsWRKY28 overexpression lines showed enhanced salinity stress tolerance, whereas the OsWRKY28 mutants displayed salt sensitivity compared to wild-type plants.
- Under salt stress treatment, the expression levels of OsbZIP05, OsHKT1;1 and OsDREB1B were significantly lower yet the level of OsHKT2;1 was significantly higher in OsWRKY28 mutants than those in wide type plants.
- OsWRKY28 confers salinity tolerance by directly binding to OsDREB1B promoter and increasing its transcriptional activity, and negatively regulates abscisic acid mediated seedling establishment in rice.
- OsWRKY28 positively regulates salinity tolerance by directly activating OsDREB1B expression in rice.
- Our data of yeast one-hybrid assay and dual-luciferase assay supported that OsWRKY28 could directly bind to the promoter of OsDREB1B to enhance salinity tolerance in rice.
- Together, OsWRKY28 confers salinity tolerance through directly targeting OsDREB1B promoter and further activating its transcription in rice.
- The transcript level of OsWRKY28 was strikingly increased under drought, chilling, salt and abscisic acid treatments.
- In addition, OsWRKY28 overexpression lines displayed hyposensitivity and the OsWRKY28 mutants showed hypersensitivity compared to wild-type plants under exogenous abscisic acid treatment.
Function-related keywords:
- transcription-factor , defense , disease-resistance , disease , blast , defense-response , magnaporthe-oryzae , root , seedling , development , oxidative-stress , oxidative , root-development , root-elongation , reproductive , architecture , homeostasis , ja , fertility , JA , phosphate , root-system-architecture , stress , salinity , salt , tolerance , salt-stress , stress-tolerance , salinity-stress , abscisic-acid , salt-sensitivity , Salt-Sensitivity
Literature:
- OsWRKY28, a PAMP-responsive transrepressor, negatively regulates innate immune responses in rice against rice blast fungus . DOI: 10.1007/s11103-013-0032-5 ; PMID: 23462973
- OsWRKY IIa Transcription Factors Modulate Rice Innate Immunity . DOI: 10.1007/s12284-010-9039-6 ; PMID: 21961049
- Building a mutant resource for the study of disease resistance in rice reveals the pivotal role of several genes involved in defence . DOI: 10.1111/j.1364-3703.2011.00731.x ; PMID: 21726398
- The WRKY Gene Family in Rice (Oryza sativa) . DOI: 10.1111/j.1744-7909.2007.00504.x
- OsWRKY28 Regulates Phosphate and Arsenate Accumulation, Root System Architecture and Fertility in Rice . DOI: 10.3389/fpls.2018.01330 ; PMID: 30258455
- OsWRKY28 positively regulates salinity tolerance by directly activating OsDREB1B expression in rice . DOI: 10.1007/s00299-022-02950-2 ; PMID: 36350394
Related News:
Gene Resources:
Sequences:
cDNA Sequence
- >LOC_Os06g44010.1 cDNA ATGGCTAAGATGCTTCCTCCTCCGAGCCAGTCAGTCCCCTCTCGCCCACCTTCTTGGCTATATATTCCTCCTCGTCGTCGCCATGGCACCTTCACTAGCTCATGCGCATTTCGGCTCTCGCCTTCTTCGCCTTCTTCTCCTCCTCCTCCTGTTCTTGATTTTCAGTATATTCAATTCATGGATTCGTGGATTGAGCAGACTTCCCTGAGCTTGGACCTCAACGTCGGCCTGCCGTCGACGGCGAGGAGATCATCGGCTCCGGCGGCGCCGATTAAGGTTCTCGTGGAGGAGAACTTCTTGTCCTTCAAGAAGGATCACGAGGTTGAGGCGCTGGAGGCGGAGCTCCGGCGAGCGAGCGAGGAGAACAAGAAGCTGACCGAGATGCTTCGGGCGGTGGTGGCCAAGTACACCGAGCTGCAGGGACAGGTCAACGACATGATGTCGGCGGCGGCGGCGGCGGCGGTCAACGCCGGGAACCACCAGTCGTCGACGTCGGAGGGCGGCTCGGTGTCGCCATCGAGGAAGCGGATCCGTAGCGTCGACAGCCTCGACGACGCCGCCCACCACCGCAAGCCATCCCCTCCGTTCGTCGCCGCCGCCGCAGCCGCGGCCTACGCCTCCCCCGACCAGATGGAGTGCACGTCGGCGGCCGCCGCCGCCGCCGCGAAGCGCGTCGTCCGCGAGGACTGCAAGCCCAAGGTCTCCAAGCGCTTCGTCCACGCCGACCCCTCCGACCTCAGCCTCGTGGTGAAGGATGGGTATCAATGGCGGAAGTACGGGCAGAAGGTGACGAAGGACAACCCGTGCCCGCGAGCCTACTTCAGGTGCTCGTTCGCGCCGGCGTGCCCGGTGAAGAAGAAGGTGCAGCGCAGCGCCGACGACAACACCGTCCTCGTCGCCACGTACGAGGGCGAGCACAACCACGCCCAGCCGCCGCACCACGACGCCGGCAGCAAGACCGCCGCCGCCGCCAAGCACTCACAGCACCAGCCGCCACCGAGCGCCGCCGCCGCCGTCGTCCGGCAGCAGCAAGAGCAGGCGGCGGCGGCCGGGCCGTCGACGGAGGTGGCGGCGAGGAAGAACCTGGCCGAGCAGATGGCGGCGACGCTGACGAGGGACCCCGGGTTCAAGGCGGCGCTCGTCACGGCGCTCTCCGGCCGGATCCTCGAGCTCTCGCCGACCAAGAACTGATCCATCGTTAGAACGCCGATGAACTTTGCTCGATTTAGCTGAGATCGATCGATCAATTTACACGGTAAAATTTTAGAGTTGATCGATTTGCATGGCTTTGATCGGAGTTAGGCTAGAGAGAGAGAGGATTAACTGTGTATATTTAGTGATTGATTTTAATTAGCTCGCTCTACACGTGCCAAGGTGGCAGTTTAAGCAAAACGTACGATAATTCGTTGCAATTTGTAATTCAGCTAGAAGATTAGTGTATTCATGGAGATCTATTCAGAGTCTCCCAGATATATATATAGAGAGAGAGATAGTAGCATTGATGTTATCGCATGTTGTTGCGATTGAACGAAAAATTAAGAAGCTAGCACATGCAAATACTTAAATTGGAAGAGGAGACTCTAGATATGAATG
CDS Sequence
- >LOC_Os06g44010.1 CDS ATGGCTAAGATGCTTCCTCCTCCGAGCCAGTCAGTCCCCTCTCGCCCACCTTCTTGGCTATATATTCCTCCTCGTCGTCGCCATGGCACCTTCACTAGCTCATGCGCATTTCGGCTCTCGCCTTCTTCGCCTTCTTCTCCTCCTCCTCCTGTTCTTGATTTTCAGTATATTCAATTCATGGATTCGTGGATTGAGCAGACTTCCCTGAGCTTGGACCTCAACGTCGGCCTGCCGTCGACGGCGAGGAGATCATCGGCTCCGGCGGCGCCGATTAAGGTTCTCGTGGAGGAGAACTTCTTGTCCTTCAAGAAGGATCACGAGGTTGAGGCGCTGGAGGCGGAGCTCCGGCGAGCGAGCGAGGAGAACAAGAAGCTGACCGAGATGCTTCGGGCGGTGGTGGCCAAGTACACCGAGCTGCAGGGACAGGTCAACGACATGATGTCGGCGGCGGCGGCGGCGGCGGTCAACGCCGGGAACCACCAGTCGTCGACGTCGGAGGGCGGCTCGGTGTCGCCATCGAGGAAGCGGATCCGTAGCGTCGACAGCCTCGACGACGCCGCCCACCACCGCAAGCCATCCCCTCCGTTCGTCGCCGCCGCCGCAGCCGCGGCCTACGCCTCCCCCGACCAGATGGAGTGCACGTCGGCGGCCGCCGCCGCCGCCGCGAAGCGCGTCGTCCGCGAGGACTGCAAGCCCAAGGTCTCCAAGCGCTTCGTCCACGCCGACCCCTCCGACCTCAGCCTCGTGGTGAAGGATGGGTATCAATGGCGGAAGTACGGGCAGAAGGTGACGAAGGACAACCCGTGCCCGCGAGCCTACTTCAGGTGCTCGTTCGCGCCGGCGTGCCCGGTGAAGAAGAAGGTGCAGCGCAGCGCCGACGACAACACCGTCCTCGTCGCCACGTACGAGGGCGAGCACAACCACGCCCAGCCGCCGCACCACGACGCCGGCAGCAAGACCGCCGCCGCCGCCAAGCACTCACAGCACCAGCCGCCACCGAGCGCCGCCGCCGCCGTCGTCCGGCAGCAGCAAGAGCAGGCGGCGGCGGCCGGGCCGTCGACGGAGGTGGCGGCGAGGAAGAACCTGGCCGAGCAGATGGCGGCGACGCTGACGAGGGACCCCGGGTTCAAGGCGGCGCTCGTCACGGCGCTCTCCGGCCGGATCCTCGAGCTCTCGCCGACCAAGAACTGA
Protein Sequence
- >LOC_Os06g44010.1 protein MAKMLPPPSQSVPSRPPSWLYIPPRRRHGTFTSSCAFRLSPSSPSSPPPPVLDFQYIQFMDSWIEQTSLSLDLNVGLPSTARRSSAPAAPIKVLVEENFLSFKKDHEVEALEAELRRASEENKKLTEMLRAVVAKYTELQGQVNDMMSAAAAAAVNAGNHQSSTSEGGSVSPSRKRIRSVDSLDDAAHHRKPSPPFVAAAAAAAYASPDQMECTSAAAAAAAKRVVREDCKPKVSKRFVHADPSDLSLVVKDGYQWRKYGQKVTKDNPCPRAYFRCSFAPACPVKKKVQRSADDNTVLVATYEGEHNHAQPPHHDAGSKTAAAAKHSQHQPPPSAAAAVVRQQQEQAAAAGPSTEVAARKNLAEQMAATLTRDPGFKAALVTALSGRILELSPTKN*