Gene Details:

Functional Descriptions:

  • Furthermore, OsZIP4 transcripts were detected in the meristem of Zn-deficient roots and shoots.
  • Transgenic rice plants overexpressing the OsZIP4 gene under the control of the cauliflower mosaic virus (CaMV) 35S promoter were produced.
  • The Zn concentration in seeds of 35S-OsZIP4 plants was four times lower compared with vector controls.
  • The Zn concentration in roots of 35S-OsZIP4 transgenic plants was 10 times higher than in those of vector controls, but it was five times lower in shoots.
  • Northern blot analysis and quantitative real-time reverse transcription-PCR revealed transcripts of OsZIP4 expression driven by the CaMV 35S promoter in roots and shoots of 35S-OsZIP4 plants, but levels of endogenous OsZIP4 transcripts were low in roots and high in shoots compared with vector controls.
  • Microarray analysis revealed that the genes expressed in shoots of 35S-OsZIP4 plants coincided with those induced in shoots of Zn-deficient plants.
  • Microarray and northern blot analysis revealed that OsZIP4 was highly expressed under conditions of Zn deficiency in roots and shoots.
  • Real-time-PCR revealed that the OsZIP4 transcripts were more abundant than those of OsZIP1 or OsZIP3 in Zn-deficient roots and shoots.
  • In situ hybridization analysis revealed that OsZIP4 in Zn-deficient rice was expressed in shoots and roots, especially in phloem cells.
  • Overexpression of the OsZIP4 zinc transporter confers disarrangement of zinc distribution in rice plants.
  • OsZIP4 is a Zn transporter that localizes to apical cells.
  • These results indicate that constitutive expression of OsZIP4 changes the Zn distribution within rice plants, and that OsZIP4 is a critical Zn transporter that must be strictly regulated.
  • Four distinct genes, OsZIP4, OsZIP5, OsZIP6, and OsZIP7 that exhibit sequence similarity to the rice ferrous ion transporter, OsIRT1, were isolated.
  • OsZIP4 complemented a Zn-uptake-deficient yeast (Saccharomyces cerevisiae) mutant, Deltazrt1,Deltazrt2, indicating that OsZIP4 is a functional transporter of Zn.
  • These results suggested that OsZIP4 is a Zn transporter that may be responsible for the translocation of Zn within rice plants.
  • OsZIP4, a novel zinc-regulated zinc transporter in rice.
  • Immunostaining analysis revealed that OsZIP4 was mainly expressed in phloem of diffuse vascular bundles (DVBs) in the nodes and the axillary meristem.
  • Mutation of OsZIP4 did not affect the total Zn uptake, but altered Zn distribution; less Zn was delivered to TB and new leaf, but more Zn was retained in the basal stems at the vegetative growth stage.
  • At the reproductive stage, mutation of OsZIP4 resulted in delayed panicles development, which is associated with decreased Zn distribution to the panicles.
  • Collectively, OsZIP4 is involved in transporting Zn to the phloem of DVBs in the nodes for subsequent distribution to TBs and other developing tissues.

Literature:

Gene Resources:

Sequences:

cDNA Sequence
  • >LOC_Os08g10630.1 cDNA CCCCTCCTCCCCACACGCCACCCGCACGCGCGCCATGGACGCCATGAGGCAGAGCACGCCGCGGGCCATGCTGCTCCTGTGCGCCGTGCTGATGCTGGCCGTGGCGCCGCCGGGCGCGGCGACGGCGGCGGCGGTGGCCGGGTGCGAGTGCGGTAATGCGGCGGCGGCGGCGGTGGCGGGGGAGGACGCGCGCGGGGCGTTGCGGCTCAAGCTCGTCGCCATCGCGTCCATCCTGGCGGCGGGCGCGGCGGGGGTGCTGGTGCCCGTGCTGGGGAGGTCGTTCGCCGCGCTCCGGCCCGACGGCGACGTGTTCTTCGCCGTCAAGGCGTTCGCGGCGGGCGTCATCCTCGCCACCGGCATGGTGCACATCCTCCCCGCCGCGTTCGACGCGCTCGCTTCGCCGTGCGGCGGAGGCAGGGGCGGCGGAGGCGGGTTCCCGTTCGCCGGGCTCGTCGCCATGGCCGCGGCCATGGCCACCATGATGATCGACTCCGTCGCCGCCGGGTACTACCGCCGGTCCCACTTCAAGAAGCCGCGCCCCGTCGACGACCCCGCCGACGCCGCGCGCGCCGCCGGGGTCGAGGAGGGCGGCGCCGAGCACGCCGGCCACGTCCACGTGCACACGCACGCCACGCACGGCCACGCCCATGGCCACGTGCACTCGCACGGCCACGGCCACGGCCACAGCCACGGCAGCGCGCCGGCGGCCGCCACCTCGCCGGAGGATGCCTCCGTCGCCGAAACAATCCGGCACAGGGTTGTCTCCCAGGTTCTGGAGCTGGGAATCCTGGTGCACTCGGTGATCATCGGGGTTTCGCTAGGCGCATCACTGAGGCCGTCGTCAATCAGGCCACTCGTCGGAGCCCTCAGCTTCCACCAGTTCTTTGAAGGCATTGGCCTTGGTGGCTGCATTGTTCAGGCAAATTTTAAGGCGAAAGCAACAGTGATCATGGCGACTTTCTTCTCCCTCACTGCTCCGGTGGGCATTGCACTGGGGATCGCAATCTCATCCAGCTATAGCAAGCACAGCTCGACCGCACTTGTCGTCGAGGGAGTCTTCAACTCTGCTGCAGCAGGGATACTGATCTACATGTCCCTGGTCGATCTCCTCGCTGCAGATTTCAACAATCCGAAGCTTCAAACAAACACAAAGCTTCAGCTGGCAGTATACCTCGCCCTCTTCCTCGGCGCTGGGATGATGTCTCTGCTTGCCATATGGGCATGAGATCTTCAGAGCAACCAAGAGCTGCAAATTTTTGAATATTGTCTCTGAAAAAGACACCCTGAGCTTAGTTTGTAGCTGACAGGGTTTGATGTTGTCATAGCATTACTGCAACCAGCTTTTGTAGAATCTCCATCAACCAGAATTGGAGAAAAAGATGGCCTGAATACGACCGAAAGTTTAGAGTTTACTGACATGAGTACACAAGTCAAAAGTTCAGGACAAATCTGATTCTTGGGCAAATGGTGTGCTTCCACCAGTATAGCACCAAATGAAGTGAACAAGAATCAAATGGGTTAGTCGAGGTAGTGGTCCTTGAACAGATTTTCTCTTCAAGTCCAAAAGCTTTGTATAAAAATGATGACCTCCTTTTGGAGTCAATGTCAATGTACAGATTCTCAGCTAGGGTAAATCCTTTTTGTATGACAAGAGCTCTGTGAAGTTTGTTCACTTGTTCAGTGAAGAATCAAATAATCCCCAGCGTTGTCTCCTTTTTCTCTA
CDS Sequence
  • >LOC_Os08g10630.1 CDS ATGGACGCCATGAGGCAGAGCACGCCGCGGGCCATGCTGCTCCTGTGCGCCGTGCTGATGCTGGCCGTGGCGCCGCCGGGCGCGGCGACGGCGGCGGCGGTGGCCGGGTGCGAGTGCGGTAATGCGGCGGCGGCGGCGGTGGCGGGGGAGGACGCGCGCGGGGCGTTGCGGCTCAAGCTCGTCGCCATCGCGTCCATCCTGGCGGCGGGCGCGGCGGGGGTGCTGGTGCCCGTGCTGGGGAGGTCGTTCGCCGCGCTCCGGCCCGACGGCGACGTGTTCTTCGCCGTCAAGGCGTTCGCGGCGGGCGTCATCCTCGCCACCGGCATGGTGCACATCCTCCCCGCCGCGTTCGACGCGCTCGCTTCGCCGTGCGGCGGAGGCAGGGGCGGCGGAGGCGGGTTCCCGTTCGCCGGGCTCGTCGCCATGGCCGCGGCCATGGCCACCATGATGATCGACTCCGTCGCCGCCGGGTACTACCGCCGGTCCCACTTCAAGAAGCCGCGCCCCGTCGACGACCCCGCCGACGCCGCGCGCGCCGCCGGGGTCGAGGAGGGCGGCGCCGAGCACGCCGGCCACGTCCACGTGCACACGCACGCCACGCACGGCCACGCCCATGGCCACGTGCACTCGCACGGCCACGGCCACGGCCACAGCCACGGCAGCGCGCCGGCGGCCGCCACCTCGCCGGAGGATGCCTCCGTCGCCGAAACAATCCGGCACAGGGTTGTCTCCCAGGTTCTGGAGCTGGGAATCCTGGTGCACTCGGTGATCATCGGGGTTTCGCTAGGCGCATCACTGAGGCCGTCGTCAATCAGGCCACTCGTCGGAGCCCTCAGCTTCCACCAGTTCTTTGAAGGCATTGGCCTTGGTGGCTGCATTGTTCAGGCAAATTTTAAGGCGAAAGCAACAGTGATCATGGCGACTTTCTTCTCCCTCACTGCTCCGGTGGGCATTGCACTGGGGATCGCAATCTCATCCAGCTATAGCAAGCACAGCTCGACCGCACTTGTCGTCGAGGGAGTCTTCAACTCTGCTGCAGCAGGGATACTGATCTACATGTCCCTGGTCGATCTCCTCGCTGCAGATTTCAACAATCCGAAGCTTCAAACAAACACAAAGCTTCAGCTGGCAGTATACCTCGCCCTCTTCCTCGGCGCTGGGATGATGTCTCTGCTTGCCATATGGGCATGA
Protein Sequence
  • >LOC_Os08g10630.1 protein MDAMRQSTPRAMLLLCAVLMLAVAPPGAATAAAVAGCECGNAAAAAVAGEDARGALRLKLVAIASILAAGAAGVLVPVLGRSFAALRPDGDVFFAVKAFAAGVILATGMVHILPAAFDALASPCGGGRGGGGGFPFAGLVAMAAAMATMMIDSVAAGYYRRSHFKKPRPVDDPADAARAAGVEEGGAEHAGHVHVHTHATHGHAHGHVHSHGHGHGHSHGSAPAAATSPEDASVAETIRHRVVSQVLELGILVHSVIIGVSLGASLRPSSIRPLVGALSFHQFFEGIGLGGCIVQANFKAKATVIMATFFSLTAPVGIALGIAISSSYSKHSSTALVVEGVFNSAAAGILIYMSLVDLLAADFNNPKLQTNTKLQLAVYLALFLGAGMMSLLAIWA*