Gene Details:
- MSU gene ID: LOC_Os11g35500
- RAPdb gene ID: Os11g0559200
- Gene Symbol: xa21
- Genome: MSU7 , IRGSP-1.0
- Species: Oryza sativa
Functional Descriptions:
- Silencing of the SDF2 genes in the xa21 rice genetic background compromises resistance to Xoo but does not affect plant growth and development.
- Interestingly, most signaling and transcriptional regulator genes were downregulated at 4 and 8 hpi, suggesting that negative regulation of cellular signaling may play a role in the xa21-mediated defense response.
- Comparison of expression profiles between xa21- and other R gene-mediated defense systems revealed interesting common responses.
- Transcriptional characteristics of xa21-mediated defense responses in rice.
- The rice pattern recognition receptor (PRR) xa21 confers race-specific resistance in leaf infection by bacterial blight Xathomonas oryzae pv.
- Rice xa21 binding protein 3 is a ubiquitin ligase required for full xa21-mediated disease resistance.
- Few components involved in transducing the xa21-mediated defense response have yet been identified.
- 1 are compromised in basal defense and xa21-mediated resistance to Xoo.
- OsWRKY62 is a negative regulator of basal and xa21-mediated defense against Xanthomonas oryzae pv. oryzae in rice.
- The transgenic plants constitutively expressing the wild-type xa21 or its GFP fusion displayed race-specific resistance to Xoo at the adult and seedling stages.
- We also established a root infection system and demonstrated that xa21 also mediated race-specific resistance responses to Xoo in the root.
- Here we report that xa21 is induced by Xoo infection and that ectopic expression of xa21 confers resistance at three leaf stage (three-week-old), overcoming the developmental limitation of xa21-mediated resistance.
- Characterization of xa21 should facilitate understanding of plant disease resistance and lead to engineered resistance in rice.
- A receptor kinase-like protein encoded by the rice disease resistance gene, xa21.
- Genetic and physical analysis of the rice bacterial blight disease resistance locus, xa21.
- Representative pathotypes were used to evaluate seven near-isogenic lines carrying individual bacterial blight resistance genes (Xa3, Xa4, xa5, Xa7, Xa10, xa13, and xa21) and gene pyramids.
- Here, we report that xa21 binds to a WRKY transcription factor, called OsWRKY62.
- The molecular genetic mechanism controlling the integration of the xa21-mediated disease resistance response with the developmental program in rice is under study in this model system.
- Expression of the xa21 gene transcript is not correlated with expression of xa21 disease resistance indicating that the developmental regulation of xa21-resistance is either controlled post-transcriptionally or by other factors.
- Short communication: developmental control of xa21-mediated disease resistance in rice.
- xa21 is a receptor-like kinase protein in rice (Oryza sativa) that confers gene-for-gene resistance to specific races of the causal agent of bacterial blight disease, Xanthomonas oryzae pv oryzae.
- The downregulation of Xb25 results in reduced levels of xa21 and compromised xa21-mediated disease resistance at the adult stage.
- Taken together, these results indicate that XB25 is required for maintaining xa21-mediated disease resistance.
- The xa21 binding protein XB25 is required for maintaining xa21-mediated disease resistance.
- Ectopic expression of xa21 also up-regulates a larger set of defense-related genes as compared to xa21 driven by the native promoter.
- These results indicate that altered regulation of xa21 expression is useful for developing enhanced resistance to Xoo at multiple developmental stages.
- The cloned rice gene xa21 confers resistance to a broad spectrum of Xoo races.
- Our current study provides an insight into the nature of the xa21-mediated resistance and a practical approach using the root cell system to further dissect the cellular signaling of the PRR during the rice-Xoo interaction.
- xa21-resistance progressively increases from the susceptible juvenile leaf 2 stage through later stages, with 100% resistance at the adult leaf 9/10 stage.
- The rice disease resistance gene, xa21, encodes a receptor kinase-like protein consisting of leucine-rich repeats in the putative extracellular domain and a serine/threonine kinase in the putative intracellular domain.
- Finally, our data suggest that the region of xa21 kinase corresponding to the RD kinase activation domain is not phosphorylated, revealing a distinct mode of action compared with the tomato Pto serine/threonine kinase conferring disease resistance.
- Biochemical characterization of the kinase domain of the rice disease resistance receptor-like kinase xa21.
- We identified 192 proteins in DRMs that included receptor-like kinases (RLKs) such as xa21, nucleotide-binding leucine-rich repeat (NB-LRR)-type disease resistance proteins, a glycosylphosphatidylinositol (GPI)-anchored protein, syntaxin, NADPH oxidase, a WD-40 repeat family protein and various GTP-binding proteins.
- Xb15 mutants display a severe cell death phenotype, induction of pathogenesis-related genes, and enhanced xa21-mediated resistance.
- Rice XB15, a protein phosphatase 2C, negatively regulates cell death and xa21-mediated innate immunity.
- The xa21 gene confers a broad and persistent resistance against BB.
- These results suggested that xa21 primed critically important genes and signaling pathways, enhancing its resistance against bacterial infection.
- Rice xa21 primed genes and pathways that are critical for combating bacterial blight infection.
- The rice xa21 receptor kinase confers robust resistance to the bacterial pathogen Xanthomonas oryzaepv.
- From this analysis, we identified eight genes that are up-regulated in both in elf18 treated EFR:xa21:GFP rice leaves and Xoo infected xa21 rice leaves.
- Mutation of the rice xa21 predicted nuclear localization sequence does not affect resistance to Xanthomonas oryzae pv. oryzae.
- The rice receptor kinase xa21 confers robust resistance to the bacterial pathogen Xanthomonas oryzaepv.
- We previously reported that xa21 is cleaved in transgenic plants overexpressing xa21 with a GFP tag (Ubi-xa21-GFP) and that the released C-terminal domain is localized to the nucleus.
- xa21 carries a predicted nuclear localization sequence (NLS) that directs the C-terminal domain to the nucleus in transient assays, whereas alanine substitutions in the NLS disrupt the nuclear localization.
- To determine if the predicted NLS is required for xa21-mediated immunity in planta, we generated transgenic plants overexpressing an xa21 variant carrying the NLS with the same alanine substitutions (Ubi-xa21nls-GFP).
- The rice immune receptor xa21 is activated by the sulfated microbial peptide required for activation of xa21-mediated immunity X (RaxX) produced by Xanthomonas oryzae pv.
- Here we demonstrate that the rice immune sensor xa21 promotes survival of rice seedlings during dehydration stress.
- xa21 expression increases deposition of lignin and cellulose in the xylem vessels and their surrounding cells.
- Inhibition of aquaporin water channels by mercuric chloride eliminates xa21-mediated dehydration survival, suggesting that xa21 enables plant survival during drought, probably by protecting xylem functionality.
- Rice immune sensor xa21 differentially enhances plant growth and survival under distinct levels of drought.
- In contrast to prevailing observations of stress tolerance genes, xa21 is also capable of enhancing rice growth during moderate drought.
- Thus, xa21 acts as a mediator for stress protection and plant growth under water-limiting conditions.
- In BC3F3 generation, the improved pyramided lines carrying a total of seven genes/QTLs (xa5 + xa13 + xa21 + Pi54 + qSBR7-1 + qSBR11-1 + qSBR11-2) were selected through molecular and phenotypic assay, and these were evaluated for resistance against bacterial blight, blast, and sheath blight pathogens under greenhouse conditions.
- We focus on knowledge gained from studies of the rice xa21 immune receptor that recognizes RaxX (required for activation of xa21 mediated immunity X), a sulfated microbial peptide secreted by the gram-negative bacterium Xanthomonas oryzae pv.
Function-related keywords:
- xoo , defense , blight , disease-resistance , defense-response , leaf , disease , bacterial-blight , transcription-factor , root , blight-disease , growth , cell-death , seedling , resistance , Kinase , receptor-kinase , pathogen , nucleus , immunity , seedlings , xylem , drought , tolerance , stress , plant-growth , cellulose , lignin , stress-tolerance , aquaporin-water-channel , sheath
Literature:
- The endoplasmic reticulum-quality control component SDF2 is essential for XA21-mediated immunity in rice . DOI: 10.1016/j.plantsci.2013.05.003 ; PMID: 23849113
- Plasma membrane localization and potential endocytosis of constitutively expressed XA21 proteins in transgenic rice . DOI: 10.1093/mp/ssq038 ; PMID: 20616165
- Biochemical characterization of the kinase domain of the rice disease resistance receptor-like kinase XA21 . DOI: 10.1074/jbc.M110999200 ; PMID: 11927577
- Transcriptional characteristics of Xa21-mediated defense responses in rice . DOI: 10.1111/j.1744-7909.2011.01032.x ; PMID: 21324061
- The cloned gene, Xa21, confers resistance to multiple Xanthomonas oryzae pv. oryzae isolates in transgenic plants . DOI: 10.1094/mpmi-9-0850 ; PMID: 8969533
- OsWRKY62 is a negative regulator of basal and Xa21-mediated defense against Xanthomonas oryzae pv. oryzae in rice . DOI: 10.1093/mp/ssn024 ; PMID: 19825552
- An XA21-associated kinase (OsSERK2) regulates immunity mediated by the XA21 and XA3 immune receptors . DOI: 10.1093/mp/ssu003 ; PMID: 24482436
- Cleavage and nuclear localization of the rice XA21 immune receptor . DOI: 10.1038/ncomms1932 ; PMID: 22735448
- Ectopic expression of rice Xa21 overcomes developmentally controlled resistance to Xanthomonas oryzae pv. oryzae . DOI: 10.1016/j.plantsci.2010.07.008 ; PMID: 21076626
- Rice XB15, a protein phosphatase 2C, negatively regulates cell death and XA21-mediated innate immunity . DOI: 10.1371/journal.pbio.0060231 ; PMID: 18817453
- Proteome analysis of detergent-resistant membranes (DRMs) associated with OsRac1-mediated innate immunity in rice . DOI: 10.1093/pcp/pcp077 ; PMID: 19502382
- An ATPase promotes autophosphorylation of the pattern recognition receptor XA21 and inhibits XA21-mediated immunity . DOI: 10.1073/pnas.0912311107 ; PMID: 20385831
- Overexpression of the endoplasmic reticulum chaperone BiP3 regulates XA21-mediated innate immunity in rice . DOI: 10.1371/journal.pone.0009262 ; PMID: 20174657
- Short communication: developmental control of Xa21-mediated disease resistance in rice . DOI: 10.1046/j.1365-313x.1999.00589.x ; PMID: 10571882
- A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21 . DOI: 10.1126/science.270.5243.1804 ; PMID: 8525370
- Xa21D encodes a receptor-like molecule with a leucine-rich repeat domain that determines race-specific recognition and is subject to adaptive evolution . DOI: 10.1105/tpc.10.5.765 ; PMID: 9596635
- Genetic and physical analysis of the rice bacterial blight disease resistance locus, Xa21 . DOI: 10.1007/BF00279649 ; PMID: 1362973
- Rice XA21 binding protein 3 is a ubiquitin ligase required for full Xa21-mediated disease resistance . DOI: 10.1105/tpc.106.046730 ; PMID: 17172358
- The XA21 binding protein XB25 is required for maintaining XA21-mediated disease resistance . DOI: 10.1111/tpj.12076 ; PMID: 23206229
- Identification of Resistance Genes Effective Against Rice Bacterial Blight Pathogen in Eastern India . DOI: 10.1094/PDIS.2001.85.5.506 ; PMID: 30823126
- Rice Xa21 primed genes and pathways that are critical for combating bacterial blight infection . DOI: 10.1038/srep12165 ; PMID: 26184504
- The rice immune receptor XA21 recognizes a tyrosine-sulfated protein from a Gram-negative bacterium . DOI: 10.1126/sciadv.1500245 ; PMID: 26601222
- XA21-specific induction of stress-related genes following Xanthomonas infection of detached rice leaves . DOI: 10.7717/peerj.2446 ; PMID: 27703843
- Mutation of the rice XA21 predicted nuclear localization sequence does not affect resistance to Xanthomonas oryzae pv. oryzae . DOI: 10.7717/peerj.2507 ; PMID: 27761320
- Biosynthesis and secretion of the microbial sulfated peptide RaxX and binding to the rice XA21 immune receptor . DOI: 10.1073/pnas.1818275116 ; PMID: 30948631
- Rice immune sensor XA21 differentially enhances plant growth and survival under distinct levels of drought . DOI: 10.1038/s41598-020-73128-7 ; PMID: 33037245
- Gene Pyramiding for Achieving Enhanced Resistance to Bacterial Blight, Blast, and Sheath Blight Diseases in Rice . DOI: 10.3389/fpls.2020.591457 ; PMID: 33329656
- Rapid genotyping of bacterial leaf blight resistant genes of rice using loop-mediated isothermal amplification assay . DOI: 10.1007/s11033-020-06077-z ; PMID: 33394228
- Plant immunity: Rice XA21-mediated resistance to bacterial infection . DOI: 10.1073/pnas.2121568119 ; PMID: 35131901
Related News:
Gene Resources:
Sequences:
cDNA Sequence
- >LOC_Os11g35500.1 cDNA ATCTCTCGCTCTTGCTGTCTTAGCTTGCACCGATATTCTCTGCATCTCGGCACGATGATATCACTCCCATTACTGCTCTTCGTCCTCTTCTTCTCTGCGCTGCTGCTCTTCCCTTCGAGCAGTGACGACGACGGTGGTGGTGATGCTGCCGGCGACGAACTCGCGCTGCTCTCTTTCAAGTCATCCCTGCTATACCAGGGGGGCCAGTCGCTGGCATCTTGGAACACGTCCGGCCATGGCCAGCACTGCACATGGGTGGGTGTCGTGTGCGGCCGCCGGCACCCACACAGGGTGGTGAAGCTGCGGCTGCGCTCCTCCAACCTGGCCGGGATCATCTCGCCGTCGCTGGGCAACCTATCCTTCCTCAGGACGCTGCAACTCAGCGACAACCACCTGTCCGGCAAGATACCCCAGGAGCTCAGCCGTCTCATCAGGCTCCAGCAACTGGTACTGAATTTCAACAGCCTATCGGGTGAGATTCCAGCTGCTTTGGGCAATCTAACCAGTCTCTCGGTTCTTGAGCTGACTAACAATACACTGTCCGGAGCAATCCCTTCATCTCTGGGCAAACTCACAGGTCTCACTGATCTTGCACTGGCTGAAAATACGCTGTCTGGTTCCATCCCATCATCTTTCGGCCAATTGCGCAGATTATCTTTCCTTAGCTTAGCCTTTAACAATTTAAGTGGAGCGATCCCAGATCCTATTTGGAACATCTCCTCTCTCACCATATTCGAAGTCATATCCAACAAGCTAAGTGGTACACTGCCTACAAATGCATTCAGTAATCTTCCTAGTCTGCAGGAGGTATACATGTATTACAACCAGTTTCATGGTCGTATCCCGGCATCGATAGGTAATGCTTCCAACATCTCAATATTTACCATTGGTTTAAACTCTTTTAGCGGTGTTGTTCCACCGGAGATTGGAAGGATGAGAAATCTTCAGAGACTAGAGCTTCCAGAAACTCTTTTGGAAGCTAAAGAAACAAATGATTGGAAATTCATGACGGCATTGACAAATTGCTCCAATCTTCAAGAAGTGGAACTGGGAGGTTGTAAATTTGGTGGAGTCCTCCCTGATTCTGTTTCCAATCTTTCCTCTTCGCTTGTATCTCTCTCCATTAGAGATAACAAAATTTCAGGGAGCTTACCTAGAGATATCGGTAATCTCGTTAATTTACAATATCTTTCTCTCGCTAACAACTCCTTGACAGGATCCCTTCCCTCTTCCTTCAGCAAGCTTAAAAATTTACGTCGTCTCACTGTAGATAACAACAAGTTAATTGGTTCTCTCCCATTCACCATCGGTAATCTTACACAACTAACTAATATGGAGGTCCAATTTAATGCCTTCGGTGGTACAATACCAAGCACACTTGGAAACCTGACCAAGCTGTTTCAAATAAATCTTGGCCACAATAACTTTATAGGGCAAATTCCCATTGAAATATTTAGCATTCCCGCACTCTCTGAAATTTTGGATGTGTCCCATCATAACTTGGAGGGATCAATACCAAAAGAAATAGGGAAACTTAAAAATATTGTCGAATTCCATGCTGATTCGAACAAATTATCGGGTGAGATCCCTAGCACCATTGGTGAATGCCAACTTCTGCAGCATCTTTTCCTGCAAAACAATTTCTTAAATGGTAGCATCCCAATAGCTCTGACTCAGTTGAAAGGTCTGGACACACTTGATCTCTCAGGTAACAATTTGTCAGGTCAGATACCTATGTCCTTAGGGGACATGCCTCTGCTCCACTCGCTGAACCTTTCGTTCAACAGCTTCCACGGTGAAGTGCCAACCAATGGTGTTTTTGCAAATGCTTCTGAAATTTACATCCAAGGCAATGCCCATATTTGCGGTGGCATACCTGAACTACATCTTCCGACGTGTTCCTTAAAATCAAGAAAGAAAAAGAAACATCAAATTCTGCTGTTAGTGGTTGTTATCTGTCTCGTTTCGACACTTGCCGTCTTTTCGTTACTCTACATGCTTCTAACCTGTCATAAGAGAAGAAAGAAAGAAGTCCCTGCAACGACATCCATGCAAGGCCACCCAATGATCACTTACAAGCAGCTGGTAAAAGCAACGGATGGTTTTTCGTCCAGCCATTTGTTGGGTTCTGGATCTTTTGGCTCTGTTTACAAAGGAGAATTTGATAGTCAAGATGGTGAAATCACAAGTCTTGTTGCCGTGAAGGTACTAAAGCTGGAAACTCCAAAGGCACTCAAGAGTTTCACGTCCGAATGCGAAACACTGCGAAATACTCGACACCGGAATCTTGTCAAGATAGTTACGATTTGCTCGAGCATCGATAACAGAGGGAATGATTTCAAAGCAATTGTGTATGACTTCATGCCCAATGGCAGTCTGGAAGATTGGCTACACCCTGAAACAAATGATCAAGCAGAGCAAAGGCACTTGACTCTGCATCAGAGAGTGACCATACTACTTGATGTTGCATGTGCATTGGACCATCTTCACTTCCATGGCCCTGAACCTATTGTACACTGTGATATTAAATCAAGCAATGTGTTGTTAGATGCTGATATGGTAGCCCATGTTGGAGACTTTGGACTTGCAAGAATACTTATTGAGGGAAGCTCATTGATGCAACAGTCAACAAGTTCGATGGGAATCAGGGGGACAATTGGTTACGCAGCACCAGAGTATGGTGTCGGGAACACTGCCTCGACACATGGAGATATTTACAGTTATGGAATTCTAGTGTTGGAAACAGTAACCGGGATGCGGCCGGCAGATAGTACATTCAGAACTGGATTGAGCCTCCGTCAGTACGTTGAACCGGGTCTACATGGTAGACTGATGGATGTTGTTGACAGGAAGCTTGGTTTGGATTCCGAGAAATGGCTTCAGGCTCGAGATGTTTCGCCATGCAGCAGTATTACTGAATGCCTTGTTTCACTGCTTAGACTTGGGCTGTCTTGCTCTCAGGAATTGCCATCGAGTAGAACGCAAGCCGGAGATGTCATCAATGAACTGCGTGCCATCAAAGAGTCTCTCTCGATGTCATCCGACATGTGAAGATGTGAGACATGCTGATGTTATGTCCGAGTATTTCGTTGTAATCTAATGTGAAGGGTGAGTGTGTGACTGCTTGGTTGTAAGCTATTTCCTGATCTGCCCATCAGATCATGTATCTGTTCTATTGTTGTATTTCTCAGAACAACCACACACCTAAGTAGGAGTACACAATAGTGTATTTGTGTAATTTCAATATTGATGCATACCCATGCTATGTGCTAAAATTATATACTGAAATTTTGAGAT
CDS Sequence
- >LOC_Os11g35500.1 CDS ATGATATCACTCCCATTACTGCTCTTCGTCCTCTTCTTCTCTGCGCTGCTGCTCTTCCCTTCGAGCAGTGACGACGACGGTGGTGGTGATGCTGCCGGCGACGAACTCGCGCTGCTCTCTTTCAAGTCATCCCTGCTATACCAGGGGGGCCAGTCGCTGGCATCTTGGAACACGTCCGGCCATGGCCAGCACTGCACATGGGTGGGTGTCGTGTGCGGCCGCCGGCACCCACACAGGGTGGTGAAGCTGCGGCTGCGCTCCTCCAACCTGGCCGGGATCATCTCGCCGTCGCTGGGCAACCTATCCTTCCTCAGGACGCTGCAACTCAGCGACAACCACCTGTCCGGCAAGATACCCCAGGAGCTCAGCCGTCTCATCAGGCTCCAGCAACTGGTACTGAATTTCAACAGCCTATCGGGTGAGATTCCAGCTGCTTTGGGCAATCTAACCAGTCTCTCGGTTCTTGAGCTGACTAACAATACACTGTCCGGAGCAATCCCTTCATCTCTGGGCAAACTCACAGGTCTCACTGATCTTGCACTGGCTGAAAATACGCTGTCTGGTTCCATCCCATCATCTTTCGGCCAATTGCGCAGATTATCTTTCCTTAGCTTAGCCTTTAACAATTTAAGTGGAGCGATCCCAGATCCTATTTGGAACATCTCCTCTCTCACCATATTCGAAGTCATATCCAACAAGCTAAGTGGTACACTGCCTACAAATGCATTCAGTAATCTTCCTAGTCTGCAGGAGGTATACATGTATTACAACCAGTTTCATGGTCGTATCCCGGCATCGATAGGTAATGCTTCCAACATCTCAATATTTACCATTGGTTTAAACTCTTTTAGCGGTGTTGTTCCACCGGAGATTGGAAGGATGAGAAATCTTCAGAGACTAGAGCTTCCAGAAACTCTTTTGGAAGCTAAAGAAACAAATGATTGGAAATTCATGACGGCATTGACAAATTGCTCCAATCTTCAAGAAGTGGAACTGGGAGGTTGTAAATTTGGTGGAGTCCTCCCTGATTCTGTTTCCAATCTTTCCTCTTCGCTTGTATCTCTCTCCATTAGAGATAACAAAATTTCAGGGAGCTTACCTAGAGATATCGGTAATCTCGTTAATTTACAATATCTTTCTCTCGCTAACAACTCCTTGACAGGATCCCTTCCCTCTTCCTTCAGCAAGCTTAAAAATTTACGTCGTCTCACTGTAGATAACAACAAGTTAATTGGTTCTCTCCCATTCACCATCGGTAATCTTACACAACTAACTAATATGGAGGTCCAATTTAATGCCTTCGGTGGTACAATACCAAGCACACTTGGAAACCTGACCAAGCTGTTTCAAATAAATCTTGGCCACAATAACTTTATAGGGCAAATTCCCATTGAAATATTTAGCATTCCCGCACTCTCTGAAATTTTGGATGTGTCCCATCATAACTTGGAGGGATCAATACCAAAAGAAATAGGGAAACTTAAAAATATTGTCGAATTCCATGCTGATTCGAACAAATTATCGGGTGAGATCCCTAGCACCATTGGTGAATGCCAACTTCTGCAGCATCTTTTCCTGCAAAACAATTTCTTAAATGGTAGCATCCCAATAGCTCTGACTCAGTTGAAAGGTCTGGACACACTTGATCTCTCAGGTAACAATTTGTCAGGTCAGATACCTATGTCCTTAGGGGACATGCCTCTGCTCCACTCGCTGAACCTTTCGTTCAACAGCTTCCACGGTGAAGTGCCAACCAATGGTGTTTTTGCAAATGCTTCTGAAATTTACATCCAAGGCAATGCCCATATTTGCGGTGGCATACCTGAACTACATCTTCCGACGTGTTCCTTAAAATCAAGAAAGAAAAAGAAACATCAAATTCTGCTGTTAGTGGTTGTTATCTGTCTCGTTTCGACACTTGCCGTCTTTTCGTTACTCTACATGCTTCTAACCTGTCATAAGAGAAGAAAGAAAGAAGTCCCTGCAACGACATCCATGCAAGGCCACCCAATGATCACTTACAAGCAGCTGGTAAAAGCAACGGATGGTTTTTCGTCCAGCCATTTGTTGGGTTCTGGATCTTTTGGCTCTGTTTACAAAGGAGAATTTGATAGTCAAGATGGTGAAATCACAAGTCTTGTTGCCGTGAAGGTACTAAAGCTGGAAACTCCAAAGGCACTCAAGAGTTTCACGTCCGAATGCGAAACACTGCGAAATACTCGACACCGGAATCTTGTCAAGATAGTTACGATTTGCTCGAGCATCGATAACAGAGGGAATGATTTCAAAGCAATTGTGTATGACTTCATGCCCAATGGCAGTCTGGAAGATTGGCTACACCCTGAAACAAATGATCAAGCAGAGCAAAGGCACTTGACTCTGCATCAGAGAGTGACCATACTACTTGATGTTGCATGTGCATTGGACCATCTTCACTTCCATGGCCCTGAACCTATTGTACACTGTGATATTAAATCAAGCAATGTGTTGTTAGATGCTGATATGGTAGCCCATGTTGGAGACTTTGGACTTGCAAGAATACTTATTGAGGGAAGCTCATTGATGCAACAGTCAACAAGTTCGATGGGAATCAGGGGGACAATTGGTTACGCAGCACCAGAGTATGGTGTCGGGAACACTGCCTCGACACATGGAGATATTTACAGTTATGGAATTCTAGTGTTGGAAACAGTAACCGGGATGCGGCCGGCAGATAGTACATTCAGAACTGGATTGAGCCTCCGTCAGTACGTTGAACCGGGTCTACATGGTAGACTGATGGATGTTGTTGACAGGAAGCTTGGTTTGGATTCCGAGAAATGGCTTCAGGCTCGAGATGTTTCGCCATGCAGCAGTATTACTGAATGCCTTGTTTCACTGCTTAGACTTGGGCTGTCTTGCTCTCAGGAATTGCCATCGAGTAGAACGCAAGCCGGAGATGTCATCAATGAACTGCGTGCCATCAAAGAGTCTCTCTCGATGTCATCCGACATGTGA
Protein Sequence
- >LOC_Os11g35500.1 protein MISLPLLLFVLFFSALLLFPSSSDDDGGGDAAGDELALLSFKSSLLYQGGQSLASWNTSGHGQHCTWVGVVCGRRHPHRVVKLRLRSSNLAGIISPSLGNLSFLRTLQLSDNHLSGKIPQELSRLIRLQQLVLNFNSLSGEIPAALGNLTSLSVLELTNNTLSGAIPSSLGKLTGLTDLALAENTLSGSIPSSFGQLRRLSFLSLAFNNLSGAIPDPIWNISSLTIFEVISNKLSGTLPTNAFSNLPSLQEVYMYYNQFHGRIPASIGNASNISIFTIGLNSFSGVVPPEIGRMRNLQRLELPETLLEAKETNDWKFMTALTNCSNLQEVELGGCKFGGVLPDSVSNLSSSLVSLSIRDNKISGSLPRDIGNLVNLQYLSLANNSLTGSLPSSFSKLKNLRRLTVDNNKLIGSLPFTIGNLTQLTNMEVQFNAFGGTIPSTLGNLTKLFQINLGHNNFIGQIPIEIFSIPALSEILDVSHHNLEGSIPKEIGKLKNIVEFHADSNKLSGEIPSTIGECQLLQHLFLQNNFLNGSIPIALTQLKGLDTLDLSGNNLSGQIPMSLGDMPLLHSLNLSFNSFHGEVPTNGVFANASEIYIQGNAHICGGIPELHLPTCSLKSRKKKKHQILLLVVVICLVSTLAVFSLLYMLLTCHKRRKKEVPATTSMQGHPMITYKQLVKATDGFSSSHLLGSGSFGSVYKGEFDSQDGEITSLVAVKVLKLETPKALKSFTSECETLRNTRHRNLVKIVTICSSIDNRGNDFKAIVYDFMPNGSLEDWLHPETNDQAEQRHLTLHQRVTILLDVACALDHLHFHGPEPIVHCDIKSSNVLLDADMVAHVGDFGLARILIEGSSLMQQSTSSMGIRGTIGYAAPEYGVGNTASTHGDIYSYGILVLETVTGMRPADSTFRTGLSLRQYVEPGLHGRLMDVVDRKLGLDSEKWLQARDVSPCSSITECLVSLLRLGLSCSQELPSSRTQAGDVINELRAIKESLSMSSDM*